bcgsc / mirna Goto Github PK

Hi there,
I'm using this pipeline to build our in-house mirna tools, but seems like if we use D. melanogaster with species code:dme and genome data dm6, it will generate the error like:

Building hashes from reference data...
Checking myRNA formatting to format reference data...Done
mirBase...Done
UCSC...
snoRNA...DBD::mysql::st execute failed: Table 'dm6.kgXref' doesn't exist at Annotate.pm line 389.
DBD::mysql::st bind_columns failed: Statement has no result columns to bind (perhaps you need to successfully call execute first, or again) at Annotate.pm line 390.
DBD::mysql::st fetchrow_arrayref failed: fetch() without execute() at Annotate.pm line 391.

I just check the dm6 genome in UCSC, seems it's lack of kgXref tables, is there any solution for this problem? thank you!

Chunhui

Hello,

we have been working with the TCGA isoform.quantification files for a while until we realized that it seems like the chromosomal end position annotated in that file does not match the actual chromosomal end position of the read. At least we experienced dramatic dicrepancies between the TCGA dataset and all other datasets we have looked at which can be only explained by an offset of 1 in the annotation of the chromosomal end position. Would you have any idea how this can be the case? Or any alternative explanations for the discrepancy we are observing?

Thank you very much for your help,

Cindy

Hello!

I am analyzing TCGA miRNA-seq data processed with BCGSC miRNA algorithm. As I can understand from the documentation and the original paper, the algorithm counts only exact matches between reads and known miRNA sequences. Does this mean that if a particular patient had a mutation in some miRNA this will affect miRNA expression very much? Specifically, for heterozygous patients (one canonical, one mutated) we would observe a half of total expression, and mismatches on both chromosomes would lead to near zero expression (near zero instead of completely zero since some RNA-level editing is theoretically possible and can "fix" the mismatch)? If my thoughts are correct, this can negatively affect many studies which involve correlation analysis. Thank you!

Hi,

I have recently started working on miRNAseq analysis and would like to follow your pipeline.

I have the reads trimmed and aligned as per your suggestions. In the next step, I'm struggling to setup the database connection for miRbase in the db_connections.cfg file.

I was able to find one for UCSC, but not able to find miRbase database connection.

hg38 genome-mysql.soe.ucsc.edu genomep password

Can you tell me where I can find details for miRbase as well? I'm trying to fill up the below line:

#mirna_21 my_host my_user my_password

Thank you!

Hi

I have downloaded scripts from http://www.bcgsc.ca/platform/bioinfo/software/adapter-trimming-for-small-rna-sequencing. When I run this script by using perl adapter_trim.pl -a TACTCTCGTATGCCGTCTTCTG SRRxxxx.fastq.gz command, the program took a long time to run without stopping. I don't understand how to deal with this problem, would you like to show a detail tutorial about trimming adpator process?

And another question is the following http link http://www.bcgsc.ca/platform/bioinfo/software/adapter-trimming-for-small-rna-sequencing is not available now, would you like to give a new http link?

Thank you very much for your help

lushuyangming