vertebrateresequencing / vr-codebase Goto Github PK
View Code? Open in Web Editor NEWThe overall codebase developed and used by the Vertebrate Resequencing group at the Sanger Institute
The overall codebase developed and used by the Vertebrate Resequencing group at the Sanger Institute
This repository contains the internally-developed software used by the Vertebrate Resequencing group a the Sanger Institute. It comprises mostly self-documented Perl code. There are both scripts and modules within subfolders. Each module has its own POD, so please use perldoc or similar for further help. Eg: $ perldoc VertRes::Utils::Sam An overview, guides and how-tos are available on the github wiki: https://github.com/VertebrateResequencing/vr-codebase/wiki INSTALLATION ------------ You will need the source version of samtools compiled with -fPIC and -m64 in the CFLAGS, and the environment variable SAMTOOLs pointing to that source directory (which should now contain bam.h and libbam.a). It is also recommended that you set PERL_INLINE_DIRECTORY to ~/.Inline $ perl Build.PL If this says you have "ERRORS/WARNINGS FOUND IN PREREQUISITES" try: $ ./Build installdeps to install missing prerequisites from CPAN. To test the code prior to use: $ perl Build.PL $ ./Build test To install: $ ./Build install (or just point your PERL5LIB to the modules subdirectory, and include the scripts subdirectory in your PATH) EXTERNAL SOFTWARE ----------------- Most likely some of the tests will fail due to you not having certain external software installed. If you don't plan on making use of that software, just ignore it when a test script for that software fails. Some software also need environment variables setup (using setenv in csh or export in bash). The following list shows the name of the software, the environment variable you need to set, and the value you should set it to, separated by commas. samtools,SAMTOOLS,/path/to/samtools/source_directory GATK,GATK,/path/to/gatk_jar_files GATK,STING_DIR,/path/to/gatk_source_code_checkout GATK,GATK_RESOURCES,/path/to/resource_files_like_reference_etc picard,PICARD,/path/to/picard_jar_files beagle,BEAGLE,/path/to/beagle_install_directory eg. to have picard work properly in our pipelines you might do: setenv PICARD /path/to/picard_jar_files or export PICARD=/path/to/picard_jar_files depending on what shell you are using. VRTRACK DATABASE ---------------- Tracking of meta-data, required for many of our pipelines, occurs in a mysql database. We use more environement variables to define how to access the mysql database: VRTRACK_HOST VRTRACK_PORT VRTRACK_RO_USER VRTRACK_RW_USER VRTRACK_PASSWORD The RW user you setup should have permissions to create and alter databases. We assume that the RO user does not require a password.
On my system (Ubuntu 12.04) bamcheck will die with a glibc memory corruption error for 300bp reads. Valgrind reveals a number of memory errors in realloc_buffers
:
==24537== Invalid write of size 4
==24537== at 0x4C2E0EB: memset (in /usr/lib/valgrind/vgpreload_memcheck-amd64-linux.so)
==24537== by 0x405640: realloc_buffers (string3.h:85)
==24537== by 0x4069AA: collect_stats (bamcheck.c:595)
==24537== by 0x40291A: main (bamcheck.c:1414)
==24537== Address 0x5cfe9f8 is 0 bytes after a block of size 2,424 alloc'd
==24537== at 0x4C2B7B2: realloc (in /usr/lib/valgrind/vgpreload_memcheck-amd64-linux.so)
==24537== by 0x405617: realloc_buffers (bamcheck.c:540)
==24537== by 0x4069AA: collect_stats (bamcheck.c:595)
==24537== by 0x40291A: main (bamcheck.c:1414)
[...]
bamcheck.c:count_mismatches_per_cycle
will segfault with some hardclipped reads.
The problem is that the read length is calculated from the query sequence field (bam_line->core.l_qseq
) which is the hardclipped length while the icycle
variable properly accounts for the hardclipped bases. Therefore, when idx is calculated:
int idx = is_fwd ? icycle : read_len-icycle-1;
read_len-icycle
can be negative. Here is a small example record to demonstrate the problem:
test_read 2163 test_ref 417 1 264H36M = 1866 1654 GTATAACGAACTCTCTGAAGTGGTTCAGTCTATGCC FF8F8EGGGGFFDEF@7<<EGF6<FGGDFF@A6<CC NM:i:1 AS:i:31 XS:i:27
In this case read_len=36
whereas icycle>=264
.
The solution is to infer the original read length directly from the CIGAR string.
This problem also exists in count_indels
.
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.