teichlab / bracer Goto Github PK

View Code? Open in Web Editor NEW

39.0 39.0 22.0 253.28 MB

BraCeR - reconstruction of B cell receptor sequences from single-cell RNAseq data

License: Other

Python 93.90% R 3.62% TeX 0.79% Shell 0.01% Dockerfile 1.68%

bracer's People

Contributors

Stargazers

Watchers

bracer's Issues

conda environment and test difference

Hi, I've been able to successfully use the docker image to run the BRACER test on my linux box and get the expected results. Unfortunately, our HPC does not support Docker. Thus, I've been trying to recreate the dependencies using bioconda. I've tried to match the versions as closely as possible -- see the conda environment file below. I've also recreated the gencode v27 index and ran the python script to reformat it. However, strangely, I consistently get only 6 reconstructed BCRs when using this environment, not 7. I've attached the STDOUT and STDERR logfiles and the conda environment file I'm using, as well as the contents of the results directory. It seems like Trinity might be failing for one of the BCRs, but I can't tell any more from the log files. Is there any chance you could support using conda for those of us who are not fortunate to have Docker availability on our HPCs?

Best,
David

environment-explicit.txt
STDIN.e1623959.txt
STDIN.o1623959.txt
results.tar.gz

build without D causes IgBlast to crash

The documentation for build indicates that D_seqs is an optional argument. However, if it is omitted, bracer assemble submits an invalid command to IgBlast that causes a crash:

Traceback (most recent call last):
  File "/nethome/schrammca/bin/bracer", line 11, in <module>
    load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
  File "/nethome/schrammca/.local/lib/python3.5/site-packages/bracer-0.1-py3.5.egg/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/nethome/schrammca/.local/lib/python3.5/site-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 366, in run
    cell = self.ig_blast()
  File "/nethome/schrammca/.local/lib/python3.5/site-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 518, in ig_blast
    self.assembled_file)
  File "/nethome/schrammca/.local/lib/python3.5/site-packages/bracer-0.1-py3.5.egg/bracerlib/bracer_func.py", line 1889, in run_IgBlast
    subprocess.check_call(command, stdout=out, stderr=DEVNULL)
  File "/sysapps/cluster/software/Anaconda/2.3.0Linux-x86_64/envs/2016-Q3-Python-3.5/lib/python3.5/subprocess.py", line 581, in check_call
    raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command '['/nethome/schrammca/bin/igblastn', '-germline_db_V', '/nethome/schrammca/bracer/resources/Hpseud/igblast_dbs/BCR_V.fa', '-germline_db_J', '/nethome/schrammca/bracer/resources/Hpseud/igblast_dbs/BCR_J.fa', '-germline_db_D', '/nethome/schrammca/bracer/resources/Hpseud/igblast_dbs/BCR_D.fa', '-domain_system', 'imgt', '-organism', 'mouse', '-ig_seqtype', 'Ig', '-show_translation', '-num_alignments_V', '20', '-num_alignments_D', '3', '-num_alignments_J', '5', '-outfmt', '7', '-query', '/hpcdata/vrc/vrc1_data/douek_lab/projects/BCRSeq/2019201_pseudogenes/bracer/05/VRC315.05.07_1.F08/Trinity_output/VRC315.05.07_1.F08_BCR_H.Trinity.fasta']' returned non-zero exit status 2

because /nethome/schrammca/bracer/resources/Hpseud/igblast_dbs/BCR_D.fa is empty and there is no associated blastdb.

Kallisto Transcriptomes

The Kallisto transcriptome link provided in readme.md no longer works; http://bio.math.berkeley.edu/kallisto/ redirects to the software's Github page, and that page says that they no longer provide indexes for download, because indexing it locally is faster than downloading it.

In this case, it'd be helpful to provide the cDNA libraries you have tested for BraCeR, if it's not feasible to put them on this repo for download.

summarise command on test_data fails

Dear BraCeR team,

I built a bracer singularity image from the docker to run it on a HPC. However, the summarise command on the test_data fails. Any idea from the error message, what happend?

Singularity bracer.simg:~> bracer summarise /data/results

 START> DefineClones

DB_FILE> changeo_input_H.tab
GROUP_FUNC> indexJunctions
GROUP_ARGS> {'mode': 'gene', 'fields': None, 'action': 'set'}
CLONE_FUNC> distanceClones
CLONE_ARGS> {'seq_field': 'JUNCTION', 'sym': 'avg', 'model': 'hh_s5f', 'linkage': 'single', 'distance': 0.2, 'norm': 'len'}
NPROC> 4

PROGRESS> Grouping sequences
PROGRESS> 12:53:18 (2) 0.0 min

PROGRESS> Assigning clones
PROGRESS> 12:53:18 [####################] 100% (2) 0.0 min

OUTPUT> changeo_input_H_clone-pass.tab
CLONES> 1
RECORDS> 2
PASS> 2
FAIL> 0
END> DefineClones

 START> DefineClones

DB_FILE> changeo_input_L.tab
GROUP_FUNC> indexJunctions
GROUP_ARGS> {'mode': 'gene', 'fields': None, 'action': 'set'}
CLONE_FUNC> distanceClones
CLONE_ARGS> {'sym': 'avg', 'linkage': 'single', 'distance': 0.2, 'norm': 'len', 'seq_field': 'JUNCTION', 'model': 'hh_s5f'}
NPROC> 4

PROGRESS> Grouping sequences
PROGRESS> 12:53:19 (3) 0.0 min

PROGRESS> Assigning clones
PROGRESS> 12:53:19 [####################] 100% (3) 0.0 min

OUTPUT> changeo_input_L_clone-pass.tab
CLONES> 2
RECORDS> 3
PASS> 3
FAIL> 0
END> DefineClones

Traceback (most recent call last):
File "/usr/local/bin/bracer", line 11, in
load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/launcher.py", line 43, in launch
Task().run()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 863, in run
self.plot_length_distributions(self.loci, length_filename_root, cells)
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 1186, in plot_length_distributions
sns.distplot(lns)
File "/usr/local/lib/python3.5/dist-packages/seaborn/distributions.py", line 224, in distplot
kdeplot(a, vertical=vertical, ax=ax, color=kde_color, **kde_kws)
File "/usr/local/lib/python3.5/dist-packages/seaborn/distributions.py", line 657, in kdeplot
cumulative=cumulative, **kwargs)
File "/usr/local/lib/python3.5/dist-packages/seaborn/distributions.py", line 284, in _univariate_kdeplot
x, y = _scipy_univariate_kde(data, bw, gridsize, cut, clip)
File "/usr/local/lib/python3.5/dist-packages/seaborn/distributions.py", line 356, in _scipy_univariate_kde
kde = stats.gaussian_kde(data, bw_method=bw)
File "/usr/local/lib/python3.5/dist-packages/scipy/stats/kde.py", line 172, in init
self.set_bandwidth(bw_method=bw_method)
File "/usr/local/lib/python3.5/dist-packages/scipy/stats/kde.py", line 499, in set_bandwidth
self._compute_covariance()
File "/usr/local/lib/python3.5/dist-packages/scipy/stats/kde.py", line 510, in _compute_covariance
self._data_inv_cov = linalg.inv(self._data_covariance)
File "/usr/local/lib/python3.5/dist-packages/scipy/linalg/basic.py", line 819, in inv
raise LinAlgError("singular matrix")
numpy.linalg.linalg.LinAlgError: singular matrix

Thanks for your help!
Uta

Output from fasta submission

Hi everyone,

I tested bracer on my single cell rna seq data. I used two approaches:
-used both paired fastq from 1 cell
The problem with this approach is that bracer recognize multiple BCR_recombinants, so It do not perform all the downstream analyses.
When I looked for the TPM of these 2 BCR_recombinant, I have one major BCR and a minor BCR (I assumed that the major clone is the right one).

-used fasta file of BCR generated with BASIC aligner
Bracer give me the same clone as the major represented one in the first approach, but when I looked in the output, I don't have the clonotype_sizes.pdf and clonotype_sizes.txt output

Is-it normal if I don't have these both outputs?

I'm also running BALDR on this dataset to confirm that the major clone is the good one.

Ps : Happy new year, thanks for this soft

What is IGHDM subtype?

Hi,
quick question: the IGHDM subtype indicates that both the IGHM and IGHD constant chain were mapped for that particular reconstructed BCR? So the cell contains the reconstructed heavy chain "attached" to the IGHM and IGHD constant chain?

Many thanks!
BW
Sabrina

A compatibility with Networkx v2.0

Quite a lot has changed in Networkx v2.0 (https://networkx.github.io/documentation/stable/release/migration_guide_from_1.x_to_2.0.html) and it breaks summarise.

For now, the requirements file specifies v1.11 exactly but we need to add v2.0 compatibility.

AssertionError: Species not found in resources

Hi!
When I test bracer, the error occured:

$ bracer test -p 8 -c bracer.conf 
Traceback (most recent call last):
  File "/SGRNJ/Public/Software/conda_env/Bracer/bin/bracer", line 33, in <module>
    sys.exit(load_entry_point('bracer==0.1', 'console_scripts', 'bracer')())
  File "/SGRNJ/Public/Software/conda_env/Bracer/lib/python3.7/site-packages/bracer-0.1-py3.7.egg/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/SGRNJ/Public/Software/conda_env/Bracer/lib/python3.7/site-packages/bracer-0.1-py3.7.egg/bracerlib/tasks.py", line 2008, in run
    trimmed_fastq2=self.trimmed_fastq2).run()
  File "/SGRNJ/Public/Software/conda_env/Bracer/lib/python3.7/site-packages/bracer-0.1-py3.7.egg/bracerlib/tasks.py", line 298, in __init__
    root=resource_dir)
  File "/SGRNJ/Public/Software/conda_env/Bracer/lib/python3.7/site-packages/bracer-0.1-py3.7.egg/bracerlib/tasks.py", line 184, in get_species_root
    assert os.path.isdir(resources_root), "Species not found in resources"
AssertionError: Species not found in resources

and my conf file content:

$ cat bracer.conf 
#Configuration file for BraCeR#

[tool_locations]
#paths to tools used by BraCeR for alignment, quantitation, etc
bowtie2_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/bowtie2
igblastn_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/igblastn
blastn_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/blastn
kallisto_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/kallisto
trinity_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/Trinity
dot_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/dot
neato_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/neato
changeo_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/
rscript_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/Rscript
dnapars_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/phylip
trim_galore_path = /SGRNJ/Public/Software/conda_env/Bracer/bin/trim_galore
cutadapt_path = /SGRNJ01/Public/Software/anaconda3/bin/cutadapt

[trinity_options]
#line below specifies maximum memory for Trinity Jellyfish component. Set it appropriately for your environment.
max_jellyfish_memory = 10G

[kallisto_transcriptomes]
Hsap = /Personal/zhouxin/software/bracer/Transcriptome_reference/Hsap/transcripts.fasta
Mmus = /Personal/zhouxin/software/bracer/Transcriptome_reference/Mmus/transcripts.fasta

[bracer_location]
#Path to where BraCeR was originally installed
bracer_path = /Personal/zhouxin/software/bracer/bracer

I have tried specified the path of bracer and bracer.conf, but it also failed

Error during bracer summarize

During summarization, an error is shown. It does not have a lot of information so I can't figure it out.

Do any of you have an idea of what I could possibly be doing wrong?

EDITED: Now no error message is shown but summarized files are empty, no BCR reconstruction is shown.


Traceback (most recent call last):
  File "/ru-auth/local/home/trezende/anaconda3/envs/py37/bin/bracer", line 11, in <module>
    load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
  File "/ru-auth/local/home/trezende/anaconda3/envs/py37/lib/python3.7/site-packages/bracer-0.1-py3.7.egg/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/ru-auth/local/home/trezende/anaconda3/envs/py37/lib/python3.7/site-packages/bracer-0.1-py3.7.egg/bracerlib/tasks.py", line 736, in run
    subdirectories = next(os.walk(self.root_dir))[1]
StopIteration

Add compatibility with bowtie 2.3 versions

BraCeR is currently not compatible with the newer versions of bowtie 2 (at least some of the 2.3 versions). It is recommended to use bowtie 2.2.8 until BraCeR has been made compatible with the newer versions. See issue #9 .

bracer summarise returns ZeroDivisionError: float division by zero

Hello,

i am trying to run bracer summarize with the ouput of bracer assemble (something i did several times for other projects). Within the folder filtered_BCR_seqs there are the BCR sequences and these are present for all my samples.

However when i try to infer the clonotype network running:

bracer summarise --config_file bracer.conf --use_unfiltered --graph_format jpeg --infer_lineage processed_files/

I have this error:

Traceback (most recent call last):
  File "/site/ne/app/x86_64/bracer/bracer", line 21, in <module>
    launch()
  File "/site/ne/app/x86_64/bracer/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/site/ne/app/x86_64/bracer/bracerlib/tasks.py", line 771, in run
    self.loci, cells)
  File "/site/ne/app/x86_64/bracer/bracerlib/tasks.py", line 1066, in write_reconstruction_statistics
    pc = round((count/float(total_cells))*100, 1)
ZeroDivisionError: float division by zero

what could be the error? It seems someting related to the statistic, but my fasta files with the BCRs assembled within the filtered_BCR_seqs folders are not empy, they all have heavy or/and light chains..

Any idea?
Thanks!

Can BraCeR be used in other species' data?

I'd like to try it on species such as Rat. Thanks.

graphviz error

Hello,

I would like to infer the lineage tree of my clones (around 140 single B-cells). I have tried to run the summarize command and infer the lineage like:

 bracer summarise --graph_format bmp --IGH_networks --infer_lineage output_test_my_data/

The summarized plot are presents but it failed to reconstruct the lineage and also to build the network files because the bmp format is not recognized. I have also tried jpeg but had the same problem. This is the error:


Error: /usr/lib64/graphviz/config6 is zero sized, or other read error.
Error: /usr/lib64/graphviz/config6 is zero sized, or other read error.
Format: "bmp" not recognized. Use one of:
Traceback (most recent call last):
  File "/site/ne/app/x86_64/bracer/bracer", line 21, in <module>
    launch()
  File "/site/ne/app/x86_64/bracer/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/site/ne/app/x86_64/bracer/bracerlib/tasks.py", line 903, in run
    self.IGH_networks)
  File "/site/ne/app/x86_64/bracer/bracerlib/bracer_func.py", line 1310, in draw_network_from_cells
    subprocess.check_call(command)
  File "/site/ne/app/x86_64/python/v3.6.7/lib/python3.6/subprocess.py", line 291, in check_call
    raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command '['/usr/bin/dot', '-Gsplines=true', '-Goverlap=false', '-Gsep=0.4', '-o', '/site/ne/home/i0439277/bracer/bracer-master/output_test_our_data_cluster/filtered_BCR_summary/clonotype_network_with_identifiers.bmp', '-T', 'bmp', '/site/ne/home/i0439277/bracer/bracer-master/output_test_our_data_cluster/filtered_BCR_summary/clonotype_network_with_identifiers.dot']' returned non-zero exit status 1.

at the same time if I run the test example and i ask to summarize and draw the lineage tree using:

 bracer test -p 4 -c bracer.conf  --infer_lineage

I still have the problem of building the network and the lineage tree and this is the error


Traceback (most recent call last):
  File "/site/ne/app/x86_64/bracer/bracer", line 21, in <module>
    launch()
  File "/site/ne/app/x86_64/bracer/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/site/ne/app/x86_64/bracer/bracerlib/tasks.py", line 2014, in run
    infer_lineage=self.infer_lineage, species='Hsap').run()
  File "/site/ne/app/x86_64/bracer/bracerlib/tasks.py", line 888, in run
    self.plot_length_distributions(self.loci, length_filename_root, cells)
  File "/site/ne/app/x86_64/bracer/bracerlib/tasks.py", line 1216, in plot_length_distributions
    sns.distplot(lns)
  File "/site/ne/app/x86_64/python/v3.6.7/lib/python3.6/site-packages/seaborn/distributions.py", line 224, in distplot
    kdeplot(a, vertical=vertical, ax=ax, color=kde_color, **kde_kws)
  File "/site/ne/app/x86_64/python/v3.6.7/lib/python3.6/site-packages/seaborn/distributions.py", line 657, in kdeplot
    cumulative=cumulative, **kwargs)
  File "/site/ne/app/x86_64/python/v3.6.7/lib/python3.6/site-packages/seaborn/distributions.py", line 284, in _univariate_kdeplot
    x, y = _scipy_univariate_kde(data, bw, gridsize, cut, clip)
  File "/site/ne/app/x86_64/python/v3.6.7/lib/python3.6/site-packages/seaborn/distributions.py", line 356, in _scipy_univariate_kde
    kde = stats.gaussian_kde(data, bw_method=bw)
  File "/site/ne/app/x86_64/python/v3.6.7/lib/python3.6/site-packages/scipy/stats/kde.py", line 172, in __init__
    self.set_bandwidth(bw_method=bw_method)
  File "/site/ne/app/x86_64/python/v3.6.7/lib/python3.6/site-packages/scipy/stats/kde.py", line 499, in set_bandwidth
    self._compute_covariance()
  File "/site/ne/app/x86_64/python/v3.6.7/lib/python3.6/site-packages/scipy/stats/kde.py", line 510, in _compute_covariance
    self._data_inv_cov = linalg.inv(self._data_covariance)
  File "/site/ne/app/x86_64/python/v3.6.7/lib/python3.6/site-packages/scipy/linalg/basic.py", line 819, in inv
    raise LinAlgError("singular matrix")
numpy.linalg.linalg.LinAlgError: singular matrix

in the folder there are only these files:

What could be the problem? Any idea?

missing bracer.conf

Hello,
i have created a conda env and istalled bracer, but when i ran the test run i get:
"Couldn't find config file: /home/ib/anaconda3/envs/BRACER/lib/python3.6/site-packages/bracer.conf"

which effectively is not in that directory

any advice?
thanks
ib

docker run failed on Mac

Hi
I tried running BraCer on my Mac using docker, here is my command:
docker run -it --rm -v $PWD:/scratch -w /scratch teichlab/bracer test -o test_data
However, I got the following error. what may cause this error, and how to solve this issue? Thanks,

Thank you so much for the help.

Best,

Docker images not working

Hi Mike et al. very excited to use BraCeR--attempted to run Docker images on 16/11/2017, ran following commands to install:

docker pull teichlab/bracer

Installation proceeded without issue.
Docker version for Windows:

Client:
 Version:      17.09.0-ce
 API version:  1.32
 Go version:   go1.8.3
 Git commit:   afdb6d4
 Built:        Tue Sep 26 22:40:09 2017
 OS/Arch:      windows/amd64

Server:
 Version:      17.09.0-ce
 API version:  1.32 (minimum version 1.12)
 Go version:   go1.8.3
 Git commit:   afdb6d4
 Built:        Tue Sep 26 22:45:38 2017
 OS/Arch:      linux/amd64
 Experimental: true

Docker version for Mac OS X (OS X 10.11.6, El Capitan):

Client: 
 Version: 17.09.0-ce
 API version: 1.32
 Go version: go1.8.3
 Git commit: afdb6d4
 Built: Tue Sep 26 22:40:09 2017
 OS/Arch: darwin/amd64

Server:
 Version 17.09.0-ce
 API version: 1.32 (minimum version 1.12)
 Go version: go1.8.3
 Git commit: afdb6d4
 Built: Tue Sep 26 22:45:38 2017
 OS/Arch: linux/amd64
 Experimental: true

On Mac OS X after running this:

docker run teichlab/bracer test

... the following break appears:

Traceback (most recent call last):
  File "/usr/local/bin/bracer", line 11, in <module>
    load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
  File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 1937, in run
    trimmed_fastq2=self.trimmed_fastq2).run()
  File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 369, in run
    self.quantify(cell)
  File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 605, in quantify
    self.trimmed_fastq2, self.keep_trimmed_reads)
  File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/bracer_func.py", line 2110, in quantify_with_kallisto
    subprocess.check_call(index_command)
  File "/usr/lib/python3.5/subprocess.py", line 271, in check_call
    raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command '['/kallisto_linux-v0.43.1/kallisto', 'index', '-i', '/bracer/test_data/results/cell1/expression_quantification/kallisto_index/cell1_transcriptome.idx', '/bracer/test_data/results/cell1/expression_quantification/kallisto_index/cell1_transcriptome.fa']' returned non-zero exit status -9

On Windows 10 after running the same command:

docker run teichlab/bracer test

... the following break appears:

Traceback (most recent call last):
  File "/usr/local/bin/bracer", line 11, in <module>
    load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
  File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 1937, in run
    trimmed_fastq2=self.trimmed_fastq2).run()
  File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 369, in run
    self.quantify(cell)
  File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 605, in quantify
    self.trimmed_fastq2, self.keep_trimmed_reads)
  File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/bracer_func.py", line 2110, in quantify_wi
th_kallisto
    subprocess.check_call(index_command)
  File "/usr/lib/python3.5/subprocess.py", line 271, in check_call
    raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command '['/kallisto_linux-v0.43.1/kallisto', 'index', '-i', '/bracer/test_data/results/c
ell1/expression_quantification/kallisto_index/cell1_transcriptome.idx', '/bracer/test_data/results/cell1/expression_quan
tification/kallisto_index/cell1_transcriptome.fa']' returned non-zero exit status -9

Docker image: FASTQ not found

Hi,
I tried to install and run Bracer but got stuck with an issue that is still unanswered (Issue#43, #43).

Therefore I tried to run the DOCKER image but got this error: OSError: [Errno 2] FASTQ file not found.

The command I used is:
docker run -it --rm -v $PWD:/scratch -w /scratch teichlab/bracer assemble --single_end --fragment_length 75 --fragment_sd 1 A1 output SS2-18-006-A1_S1_merged_R1_001.fastq

Any idea why the FASTQ file can't be found?

Thank you for the help!

Best regards,
Sabrina

imgt gapped database

Hi!

I want to perform run_IgBlast_IMGT_gaps_for_cell in TCR data. Because Bracer summarise output is more abundant than Tracer. What do you think of its viability? Besides, I'd like to ask where do you get imgt_gapped_resources/igblast_dbs?

Thank you!

bracer test failed on Recombinant-derived reads with Biopython errors

I'm using RHEL with Python 3.6.1, biopython 1.70, igBLAST 1.9, blast 2.2.31, trinity 2.6.6. The software was installed with git as my system does not allow Docker.

I issued bracer test -p 4 -c ./Green/CommonCode/bracer.conf -o ./bracer_test/ > bracer-out.txt 2>&1 and the output are as follows:

56438 reads; of these:
  56438 (100.00%) were paired; of these:
    35350 (62.64%) aligned concordantly 0 times
    21088 (37.36%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    35350 pairs aligned concordantly 0 times; of these:
      73 (0.21%) aligned discordantly 1 time
    ----
    35277 pairs aligned 0 times concordantly or discordantly; of these:
      70554 mates make up the pairs; of these:
        69268 (98.18%) aligned 0 times
        232 (0.33%) aligned exactly 1 time
        1054 (1.49%) aligned >1 times
38.63% overall alignment rate
56438 reads; of these:
  56438 (100.00%) were paired; of these:
    56438 (100.00%) aligned concordantly 0 times
    0 (0.00%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    56438 pairs aligned concordantly 0 times; of these:
      0 (0.00%) aligned discordantly 1 time
    ----
    56438 pairs aligned 0 times concordantly or discordantly; of these:
      112876 mates make up the pairs; of these:
        112876 (100.00%) aligned 0 times
        0 (0.00%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
0.00% overall alignment rate
56438 reads; of these:
  56438 (100.00%) were paired; of these:
    48319 (85.61%) aligned concordantly 0 times
    8119 (14.39%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    48319 pairs aligned concordantly 0 times; of these:
      114 (0.24%) aligned discordantly 1 time
    ----
    48205 pairs aligned 0 times concordantly or discordantly; of these:
      96410 mates make up the pairs; of these:
        95663 (99.23%) aligned 0 times
        195 (0.20%) aligned exactly 1 time
        552 (0.57%) aligned >1 times
15.25% overall alignment rate
56438 reads; of these:
  56438 (100.00%) were paired; of these:
    31766 (56.28%) aligned concordantly 0 times
    24672 (43.72%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    31766 pairs aligned concordantly 0 times; of these:
      270 (0.85%) aligned discordantly 1 time
    ----
    31496 pairs aligned 0 times concordantly or discordantly; of these:
      62992 mates make up the pairs; of these:
        61549 (97.71%) aligned 0 times
        144 (0.23%) aligned exactly 1 time
        1299 (2.06%) aligned >1 times
45.47% overall alignment rate


     ______  ____   ____  ____   ____  ______  __ __
    |      ||    \ |    ||    \ |    ||      ||  |  |
    |      ||  D  ) |  | |  _  | |  | |      ||  |  |
    |_|  |_||    /  |  | |  |  | |  | |_|  |_||  ~  |
      |  |  |    \  |  | |  |  | |  |   |  |  |___, |
      |  |  |  .  \ |  | |  |  | |  |   |  |  |     |
      |__|  |__|\_||____||__|__||____|  |__|  |____/


Left read files: $VAR1 = [
          '/scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_H_1.fastq'
        ];
Right read files: $VAR1 = [
          '/scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_H_2.fastq'
        ];
Trinity version: Trinity-v2.6.6
-ERROR: couldn't run the network check to confirm latest Trinity software version.

Tuesday, August 14, 2018: 11:20:01	CMD: java -Xmx64m -XX:ParallelGCThreads=2  -jar /risapps/noarch/trinity/2.6.6/util/support_scripts/ExitTester.jar 0
Tuesday, August 14, 2018: 11:20:02	CMD: java -Xmx64m -XX:ParallelGCThreads=2  -jar /risapps/noarch/trinity/2.6.6/util/support_scripts/ExitTester.jar 1
Tuesday, August 14, 2018: 11:20:02	CMD: mkdir -p /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_H
Tuesday, August 14, 2018: 11:20:02	CMD: mkdir -p /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis


----------------------------------------------------------------------------------
-------------- Trinity Phase 1: Clustering of RNA-Seq Reads  ---------------------
----------------------------------------------------------------------------------

Converting input files. (in parallel)Tuesday, August 14, 2018: 11:20:02	CMD: cat /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_H_1.fastq | seqtk-trinity seq -A - >> left.fa
Tuesday, August 14, 2018: 11:20:02	CMD: touch left.fa.ok
Tuesday, August 14, 2018: 11:20:02	CMD: cat /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_H_2.fastq | seqtk-trinity seq -A - >> right.fa
Tuesday, August 14, 2018: 11:20:02	CMD: touch right.fa.ok
Tuesday, August 14, 2018: 11:20:02	CMD: touch left.fa.ok right.fa.ok
Tuesday, August 14, 2018: 11:20:02	CMD: cat left.fa right.fa > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa
Tuesday, August 14, 2018: 11:20:02	CMD: touch /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa.ok
-------------------------------------------
----------- Jellyfish  --------------------
-- (building a k-mer catalog from reads) --
-------------------------------------------

* Running CMD: jellyfish count -t 4 -m 25 -s 100000000  --canonical  /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa
* Running CMD: jellyfish dump -L 1 mer_counts.jf > jellyfish.kmers.fa
* Running CMD: jellyfish histo -t 4 -o jellyfish.kmers.fa.histo mer_counts.jf
----------------------------------------------
--------------- Inchworm ---------------------
-- (Linear contig construction from k-mers) --
----------------------------------------------

* Running CMD: /risapps/noarch/trinity/2.6.6/Inchworm/bin//inchworm --kmers jellyfish.kmers.fa --run_inchworm -K 25 -L 25 --monitor 1   --DS  --num_threads 4  --PARALLEL_IWORM  > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa.tmp
* Running CMD: mv /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa.tmp /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa
Tuesday, August 14, 2018: 11:20:03	CMD: touch /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa.finished
NON_FATAL_EXCEPTION: WARNING, no Inchworm output is detected at: /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa at /risapps/noarch/trinity/2.6.6/Trinity line 1616.

# No butterfly assemblies to report.


     ______  ____   ____  ____   ____  ______  __ __
    |      ||    \ |    ||    \ |    ||      ||  |  |
    |      ||  D  ) |  | |  _  | |  | |      ||  |  |
    |_|  |_||    /  |  | |  |  | |  | |_|  |_||  ~  |
      |  |  |    \  |  | |  |  | |  |   |  |  |___, |
      |  |  |  .  \ |  | |  |  | |  |   |  |  |     |
      |__|  |__|\_||____||__|__||____|  |__|  |____/


Left read files: $VAR1 = [
          '/scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_K_1.fastq'
        ];
Right read files: $VAR1 = [
          '/scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_K_2.fastq'
        ];
Trinity version: Trinity-v2.6.6
-ERROR: couldn't run the network check to confirm latest Trinity software version.

Tuesday, August 14, 2018: 11:20:03	CMD: java -Xmx64m -XX:ParallelGCThreads=2  -jar /risapps/noarch/trinity/2.6.6/util/support_scripts/ExitTester.jar 0
Tuesday, August 14, 2018: 11:20:03	CMD: java -Xmx64m -XX:ParallelGCThreads=2  -jar /risapps/noarch/trinity/2.6.6/util/support_scripts/ExitTester.jar 1
Tuesday, August 14, 2018: 11:20:04	CMD: mkdir -p /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K
Tuesday, August 14, 2018: 11:20:04	CMD: mkdir -p /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis


----------------------------------------------------------------------------------
-------------- Trinity Phase 1: Clustering of RNA-Seq Reads  ---------------------
----------------------------------------------------------------------------------

Converting input files. (in parallel)Tuesday, August 14, 2018: 11:20:04	CMD: cat /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_K_1.fastq | seqtk-trinity seq -A - >> left.fa
Tuesday, August 14, 2018: 11:20:04	CMD: cat /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_K_2.fastq | seqtk-trinity seq -A - >> right.fa
Tuesday, August 14, 2018: 11:20:04	CMD: touch left.fa.ok
Tuesday, August 14, 2018: 11:20:04	CMD: touch right.fa.ok
Tuesday, August 14, 2018: 11:20:04	CMD: touch left.fa.ok right.fa.ok
Tuesday, August 14, 2018: 11:20:04	CMD: cat left.fa right.fa > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa
Tuesday, August 14, 2018: 11:20:04	CMD: touch /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa.ok
-------------------------------------------
----------- Jellyfish  --------------------
-- (building a k-mer catalog from reads) --
-------------------------------------------

* Running CMD: jellyfish count -t 4 -m 25 -s 100000000  --canonical  /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa
* Running CMD: jellyfish dump -L 1 mer_counts.jf > jellyfish.kmers.fa
* Running CMD: jellyfish histo -t 4 -o jellyfish.kmers.fa.histo mer_counts.jf
----------------------------------------------
--------------- Inchworm ---------------------
-- (Linear contig construction from k-mers) --
----------------------------------------------

* Running CMD: /risapps/noarch/trinity/2.6.6/Inchworm/bin//inchworm --kmers jellyfish.kmers.fa --run_inchworm -K 25 -L 25 --monitor 1   --DS  --num_threads 4  --PARALLEL_IWORM  > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa.tmp
* Running CMD: mv /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa.tmp /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa
Tuesday, August 14, 2018: 11:20:05	CMD: touch /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa.finished
--------------------------------------------------------
-------------------- Chrysalis -------------------------
-- (Contig Clustering & de Bruijn Graph Construction) --
--------------------------------------------------------

inchworm_target: /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa
bowite_reads_fa: /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa
chrysalis_reads_fa: /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa
* Running CMD: /risapps/noarch/trinity/2.6.6/util/support_scripts/filter_iworm_by_min_length_or_cov.pl /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa 100 10 > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/inchworm.K25.L25.DS.fa.min100
* Running CMD: /risapps/noarch/bowtie2/2.3.4.2/bowtie2-build --threads 4 -o 3 /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/inchworm.K25.L25.DS.fa.min100 /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/inchworm.K25.L25.DS.fa.min100 1>/dev/null
* Running CMD: bash -c " set -o pipefail;/risapps/noarch/bowtie2/2.3.4.2/bowtie2 --local -k 2 --no-unal --threads 4 -f --score-min G,20,4 -x /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/inchworm.K25.L25.DS.fa.min100 /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa  | samtools view -@ 4 -F4 -Sb - | samtools sort -m 536870912 -@ 4 -no - - > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/iworm.bowtie.nameSorted.bam" 
* Running CMD: /risapps/noarch/trinity/2.6.6/util/support_scripts/scaffold_iworm_contigs.pl /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/iworm.bowtie.nameSorted.bam /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/iworm_scaffolds.txt
* Running CMD: /risapps/noarch/trinity/2.6.6/Chrysalis/GraphFromFasta -i /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa -r /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa -min_contig_length 200 -min_glue 2 -glue_factor 0.05 -min_iso_ratio 0.05 -t 4 -k 24 -kk 48  > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/iworm_cluster_welds_graph.txt
* Running CMD: /risapps/noarch/trinity/2.6.6/Chrysalis/BubbleUpClustering -i /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa  -weld_graph /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/iworm_cluster_welds_graph.txt -min_contig_length 200  > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/GraphFromIwormFasta.out
* Running CMD: /risapps/noarch/trinity/2.6.6/Chrysalis/CreateIwormFastaBundle -i /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/GraphFromIwormFasta.out -o /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/bundled_iworm_contigs.fasta -min 200
* Running CMD: /risapps/noarch/trinity/2.6.6/Chrysalis/ReadsToTranscripts -i /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa -f /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/bundled_iworm_contigs.fasta -o /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/readsToComponents.out -t 4 -max_mem_reads 50000000 
* Running CMD: /bin/sort -T . -S 4G -k 1,1n /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/readsToComponents.out > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/readsToComponents.out.sort
Tuesday, August 14, 2018: 11:20:08	CMD: mkdir -p /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/read_partitions/Fb_0/CBin_0
Tuesday, August 14, 2018: 11:20:08	CMD: touch /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/partitioned_reads.files.list.ok
Tuesday, August 14, 2018: 11:20:08	CMD: /risapps/noarch/trinity/2.6.6/util/support_scripts/write_partitioned_trinity_cmds.pl --reads_list_file /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/partitioned_reads.files.list --CPU 1 --max_memory 1G  --run_as_paired  --seqType fa --trinity_complete --full_cleanup  > recursive_trinity.cmds
Tuesday, August 14, 2018: 11:20:08	CMD: touch recursive_trinity.cmds.ok
Tuesday, August 14, 2018: 11:20:08	CMD: touch recursive_trinity.cmds.ok


--------------------------------------------------------------------------------
------------ Trinity Phase 2: Assembling Clusters of Reads ---------------------
--------------------------------------------------------------------------------

Tuesday, August 14, 2018: 11:20:08	CMD: /risapps/noarch/trinity/2.6.6/trinity-plugins/BIN/ParaFly -c recursive_trinity.cmds -CPU 4 -v -shuffle 
Number of Commands: 1

succeeded(1)   100% completed.    

All commands completed successfully. :-)



** Harvesting all assembled transcripts into a single multi-fasta file...

Tuesday, August 14, 2018: 11:20:14	CMD: find /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/read_partitions/ -name '*inity.fasta'  | /risapps/noarch/trinity/2.6.6/util/support_scripts/partitioned_trinity_aggregator.pl TRINITY_DN > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/Trinity.fasta.tmp
Tuesday, August 14, 2018: 11:20:14	CMD: mv /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/Trinity.fasta.tmp /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K.Trinity.fasta


###################################################################
Butterfly assemblies are written to /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K.Trinity.fasta
###################################################################


Tuesday, August 14, 2018: 11:20:14	CMD: /risapps/noarch/trinity/2.6.6/util/support_scripts/get_Trinity_gene_to_trans_map.pl /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K.Trinity.fasta > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_K.Trinity.fasta.gene_trans_map


     ______  ____   ____  ____   ____  ______  __ __
    |      ||    \ |    ||    \ |    ||      ||  |  |
    |      ||  D  ) |  | |  _  | |  | |      ||  |  |
    |_|  |_||    /  |  | |  |  | |  | |_|  |_||  ~  |
      |  |  |    \  |  | |  |  | |  |   |  |  |___, |
      |  |  |  .  \ |  | |  |  | |  |   |  |  |     |
      |__|  |__|\_||____||__|__||____|  |__|  |____/


Left read files: $VAR1 = [
          '/scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_L_1.fastq'
        ];
Right read files: $VAR1 = [
          '/scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_L_2.fastq'
        ];
Trinity version: Trinity-v2.6.6
-ERROR: couldn't run the network check to confirm latest Trinity software version.

Tuesday, August 14, 2018: 11:20:14	CMD: java -Xmx64m -XX:ParallelGCThreads=2  -jar /risapps/noarch/trinity/2.6.6/util/support_scripts/ExitTester.jar 0
Tuesday, August 14, 2018: 11:20:15	CMD: java -Xmx64m -XX:ParallelGCThreads=2  -jar /risapps/noarch/trinity/2.6.6/util/support_scripts/ExitTester.jar 1
Tuesday, August 14, 2018: 11:20:15	CMD: mkdir -p /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L
Tuesday, August 14, 2018: 11:20:15	CMD: mkdir -p /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis


----------------------------------------------------------------------------------
-------------- Trinity Phase 1: Clustering of RNA-Seq Reads  ---------------------
----------------------------------------------------------------------------------

Converting input files. (in parallel)Tuesday, August 14, 2018: 11:20:15	CMD: cat /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_L_1.fastq | seqtk-trinity seq -A - >> left.fa
Tuesday, August 14, 2018: 11:20:15	CMD: cat /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/aligned_reads/cell1_BCR_L_2.fastq | seqtk-trinity seq -A - >> right.fa
Tuesday, August 14, 2018: 11:20:15	CMD: touch right.fa.ok
Tuesday, August 14, 2018: 11:20:15	CMD: touch left.fa.ok
Tuesday, August 14, 2018: 11:20:15	CMD: touch left.fa.ok right.fa.ok
Tuesday, August 14, 2018: 11:20:15	CMD: cat left.fa right.fa > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa
Tuesday, August 14, 2018: 11:20:15	CMD: touch /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa.ok
-------------------------------------------
----------- Jellyfish  --------------------
-- (building a k-mer catalog from reads) --
-------------------------------------------

* Running CMD: jellyfish count -t 4 -m 25 -s 100000000  --canonical  /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa
* Running CMD: jellyfish dump -L 1 mer_counts.jf > jellyfish.kmers.fa
* Running CMD: jellyfish histo -t 4 -o jellyfish.kmers.fa.histo mer_counts.jf
----------------------------------------------
--------------- Inchworm ---------------------
-- (Linear contig construction from k-mers) --
----------------------------------------------

* Running CMD: /risapps/noarch/trinity/2.6.6/Inchworm/bin//inchworm --kmers jellyfish.kmers.fa --run_inchworm -K 25 -L 25 --monitor 1   --DS  --num_threads 4  --PARALLEL_IWORM  > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa.tmp
* Running CMD: mv /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa.tmp /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa
Tuesday, August 14, 2018: 11:20:16	CMD: touch /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa.finished
--------------------------------------------------------
-------------------- Chrysalis -------------------------
-- (Contig Clustering & de Bruijn Graph Construction) --
--------------------------------------------------------

inchworm_target: /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa
bowite_reads_fa: /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa
chrysalis_reads_fa: /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa
* Running CMD: /risapps/noarch/trinity/2.6.6/util/support_scripts/filter_iworm_by_min_length_or_cov.pl /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa 100 10 > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/inchworm.K25.L25.DS.fa.min100
* Running CMD: /risapps/noarch/bowtie2/2.3.4.2/bowtie2-build --threads 4 -o 3 /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/inchworm.K25.L25.DS.fa.min100 /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/inchworm.K25.L25.DS.fa.min100 1>/dev/null
* Running CMD: bash -c " set -o pipefail;/risapps/noarch/bowtie2/2.3.4.2/bowtie2 --local -k 2 --no-unal --threads 4 -f --score-min G,20,4 -x /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/inchworm.K25.L25.DS.fa.min100 /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa  | samtools view -@ 4 -F4 -Sb - | samtools sort -m 536870912 -@ 4 -no - - > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/iworm.bowtie.nameSorted.bam" 
* Running CMD: /risapps/noarch/trinity/2.6.6/util/support_scripts/scaffold_iworm_contigs.pl /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/iworm.bowtie.nameSorted.bam /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/iworm_scaffolds.txt
* Running CMD: /risapps/noarch/trinity/2.6.6/Chrysalis/GraphFromFasta -i /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa -r /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa -min_contig_length 200 -min_glue 2 -glue_factor 0.05 -min_iso_ratio 0.05 -t 4 -k 24 -kk 48  > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/iworm_cluster_welds_graph.txt
* Running CMD: /risapps/noarch/trinity/2.6.6/Chrysalis/BubbleUpClustering -i /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa  -weld_graph /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/iworm_cluster_welds_graph.txt -min_contig_length 200  > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/GraphFromIwormFasta.out
* Running CMD: /risapps/noarch/trinity/2.6.6/Chrysalis/CreateIwormFastaBundle -i /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/GraphFromIwormFasta.out -o /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/bundled_iworm_contigs.fasta -min 200
* Running CMD: /risapps/noarch/trinity/2.6.6/Chrysalis/ReadsToTranscripts -i /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa -f /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/bundled_iworm_contigs.fasta -o /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/readsToComponents.out -t 4 -max_mem_reads 50000000 
* Running CMD: /bin/sort -T . -S 4G -k 1,1n /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/readsToComponents.out > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/readsToComponents.out.sort
Tuesday, August 14, 2018: 11:20:20	CMD: mkdir -p /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/read_partitions/Fb_0/CBin_0
Tuesday, August 14, 2018: 11:20:20	CMD: touch /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/partitioned_reads.files.list.ok
Tuesday, August 14, 2018: 11:20:20	CMD: /risapps/noarch/trinity/2.6.6/util/support_scripts/write_partitioned_trinity_cmds.pl --reads_list_file /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/partitioned_reads.files.list --CPU 1 --max_memory 1G  --run_as_paired  --seqType fa --trinity_complete --full_cleanup  > recursive_trinity.cmds
Tuesday, August 14, 2018: 11:20:20	CMD: touch recursive_trinity.cmds.ok
Tuesday, August 14, 2018: 11:20:20	CMD: touch recursive_trinity.cmds.ok


--------------------------------------------------------------------------------
------------ Trinity Phase 2: Assembling Clusters of Reads ---------------------
--------------------------------------------------------------------------------

Tuesday, August 14, 2018: 11:20:20	CMD: /risapps/noarch/trinity/2.6.6/trinity-plugins/BIN/ParaFly -c recursive_trinity.cmds -CPU 4 -v -shuffle 
Number of Commands: 1

succeeded(1)   100% completed.    

All commands completed successfully. :-)



** Harvesting all assembled transcripts into a single multi-fasta file...

Tuesday, August 14, 2018: 11:20:33	CMD: find /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/read_partitions/ -name '*inity.fasta'  | /risapps/noarch/trinity/2.6.6/util/support_scripts/partitioned_trinity_aggregator.pl TRINITY_DN > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/Trinity.fasta.tmp
Tuesday, August 14, 2018: 11:20:33	CMD: mv /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/Trinity.fasta.tmp /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L.Trinity.fasta


###################################################################
Butterfly assemblies are written to /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L.Trinity.fasta
###################################################################


Tuesday, August 14, 2018: 11:20:33	CMD: /risapps/noarch/trinity/2.6.6/util/support_scripts/get_Trinity_gene_to_trans_map.pl /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L.Trinity.fasta > /scratch/lym_myl_rsch/mma/bracer_test/results/cell1/Trinity_output/Trinity_cell1_BCR_L.Trinity.fasta.gene_trans_map
       START> MakeDB
     ALIGNER> IgBLAST
ALIGNER_FILE> cell1_BCR_H.fmt7
    SEQ_FILE> cell1_BCR_H.Trinity.fasta
     PARTIAL> False
      SCORES> True
     REGIONS> True
     ASIS_ID> False
  ASIS_CALLS> False


PROGRESS> 11:20:45 |Loading files       | 0.0 min
PROGRESS> 11:20:45 |Done                | 0.0 min

PROGRESS> 11:20:45 |                    |   0% (0) 0.0 min
PROGRESS> 11:20:45 |##########          |  50% (1) 0.0 min
PROGRESS> 11:20:45 |####################| 100% (2) 0.0 min

OUTPUT> cell1_BCR_H_db-pass.tab
  PASS> 1
  FAIL> 1
   END> MakeDb

       START> MakeDB
     ALIGNER> IgBLAST
ALIGNER_FILE> cell1_BCR_K.fmt7
    SEQ_FILE> cell1_BCR_K.Trinity.fasta
     PARTIAL> False
      SCORES> True
     REGIONS> True
     ASIS_ID> False
  ASIS_CALLS> False


PROGRESS> 11:20:45 |Loading files       | 0.0 min
PROGRESS> 11:20:45 |Done                | 0.0 min

PROGRESS> 11:20:45 |                    |   0% (0) 0.0 min
PROGRESS> 11:20:45 |####################| 100% (1) 0.0 min

OUTPUT> cell1_BCR_K_db-pass.tab
  PASS> 1
  FAIL> 0
   END> MakeDb

       START> MakeDB
     ALIGNER> IgBLAST
ALIGNER_FILE> cell1_BCR_L.fmt7
    SEQ_FILE> cell1_BCR_L.Trinity.fasta
     PARTIAL> False
      SCORES> True
     REGIONS> True
     ASIS_ID> False
  ASIS_CALLS> False


PROGRESS> 11:20:46 |Loading files       | 0.0 min
PROGRESS> 11:20:46 |Done                | 0.0 min

PROGRESS> 11:20:46 |                    |   0% (0) 0.0 min
PROGRESS> 11:20:46 |####################| 100% (1) 0.0 min

OUTPUT> cell1_BCR_L_db-pass.tab
  PASS> 1
  FAIL> 0
   END> MakeDb

##Finding recombinant-derived reads##
Attempting new assembly for ['BCR_H', 'BCR_K', 'BCR_L']

Detected average R1 read length: 
50.0
Short read length detected. BraCeR will run two rounds of alignment for heavy chain

##BCR_H##
##BCR_K##
##BCR_L##

##Assembling Trinity Contigs##
##BCR_H##
Trinity failed for locus
##BCR_K##
##BCR_L##

##Running BLAST##
Performing Blast on ['BCR_H', 'BCR_K', 'BCR_L']
##BCR_H##
##BCR_K##
##BCR_L##

##Running IgBLAST##
Ig_seqtype: Ig
Performing IgBlast on ['BCR_H', 'BCR_K', 'BCR_L']
##BCR_H##
##BCR_K##
##BCR_L##


Traceback (most recent call last):
  File "/scratch/lym_myl_rsch/mma/.local/lib/python3.6/site-packages/Bio/Data/CodonTable.py", line 399, in __getitem__
    self.ambiguous_nucleotide)
  File "/scratch/lym_myl_rsch/mma/.local/lib/python3.6/site-packages/Bio/Data/CodonTable.py", line 214, in list_possible_proteins
    x1 = ambiguous_nucleotide_values[c1]
KeyError: '0'

During handling of the above exception, another exception occurred:

Traceback (most recent call last):
  File "/scratch/lym_myl_rsch/mma/.local/lib/python3.6/site-packages/Bio/Seq.py", line 2588, in _translate_str
    amino_acids.append(forward_table[codon])
  File "/scratch/lym_myl_rsch/mma/.local/lib/python3.6/site-packages/Bio/Data/CodonTable.py", line 402, in __getitem__
    raise KeyError(codon)  # stop codon
KeyError: '0.9'

During handling of the above exception, another exception occurred:

Traceback (most recent call last):
  File "/risapps/rhel6/python/3.6/bin/bracer", line 11, in <module>
    load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
  File "/risapps/rhel6/python/3.6/lib/python3.6/site-packages/bracer-0.1-py3.6.egg/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/risapps/rhel6/python/3.6/lib/python3.6/site-packages/bracer-0.1-py3.6.egg/bracerlib/tasks.py", line 1945, in run
    trimmed_fastq2=self.trimmed_fastq2).run()
  File "/risapps/rhel6/python/3.6/lib/python3.6/site-packages/bracer-0.1-py3.6.egg/bracerlib/tasks.py", line 366, in run
    cell = self.ig_blast()
  File "/risapps/rhel6/python/3.6/lib/python3.6/site-packages/bracer-0.1-py3.6.egg/bracerlib/tasks.py", line 539, in ig_blast
    self.max_junc_len)
  File "/risapps/rhel6/python/3.6/lib/python3.6/site-packages/bracer-0.1-py3.6.egg/bracerlib/io.py", line 129, in parse_IgBLAST
    loci, max_junc_len, assembled_file)
  File "/risapps/rhel6/python/3.6/lib/python3.6/site-packages/bracer-0.1-py3.6.egg/bracerlib/bracer_func.py", line 348, in find_possible_alignments
    cdr3 = Seq(str(cdr3_seq), generic_dna).translate()
  File "/scratch/lym_myl_rsch/mma/.local/lib/python3.6/site-packages/Bio/Seq.py", line 1163, in translate
    cds, gap=gap)
  File "/scratch/lym_myl_rsch/mma/.local/lib/python3.6/site-packages/Bio/Seq.py", line 2605, in _translate_str
    "Codon '{0}' is invalid".format(codon))
Bio.Data.CodonTable.TranslationError: Codon '0.9' is invalid

The error seems to be from Biopython. Can you confirm 1.7.0 is the one to use?

linalgerror

Hi bracer team,

thanks for writing this software. I am trying to use the program but it is failing the tests. I downloaded bracer today
git clone https://github.com/Teichlab/bracer.git
Then I created a new conda environment for bracer. I installed numpy and biopython in that environment. then installed the other modules using pip3 and the requirements.txt file.

When I run the test: ./bracer test -c bracer.conf

I get this error:

PROGRESS> 14:07:16 |Loading files | 0.0 min PROGRESS> 14:07:16 |Done | 0.0 min

PROGRESS> 14:07:16 | | 0% (0) 0.0 min^MPROGRESS> 14:07:16 |########## | 50% (1) 0.0 min PROGRESS> 14:07:16 |####################| 100% (2) 0.0 min

OUTPUT> cell1_BCR_L_db-pass.tab
PASS> 2
FAIL> 0
END> MakeDb

   START> DefineClones
    FILE> changeo_input_H.tab

SEQ_FIELD> JUNCTION
V_FIELD> V_CALL
J_FIELD> J_CALL
MAX_MISSING> 0

/home/users/mswift2/.local/lib/python3.6/site-packages/scipy/stats/stats.py:1713: FutureWarning: Using a non-tuple sequence for multidimensional indexing is deprecated; use arr[tuple(seq)] instead of arr[seq]. In the future this will be interpreted as an array index, arr[np.array(seq)], which will result either in an error or a different result.
return np.add.reduce(sorted[indexer] * weights, axis=axis) / sumval
Traceback (most recent call last):
File "./bracer", line 21, in
launch()
File "/oak/stanford/groups/quake/mswift/resources/bracer/bracerlib/launcher.py", line 43, in launch
Task().run()
File "/oak/stanford/groups/quake/mswift/resources/bracer/bracerlib/tasks.py", line 1951, in run
infer_lineage=self.infer_lineage, species='Hsap').run()
File "/oak/stanford/groups/quake/mswift/resources/bracer/bracerlib/tasks.py", line 867, in run
self.plot_length_distributions(self.loci, length_filename_root, cells)
File "/oak/stanford/groups/quake/mswift/resources/bracer/bracerlib/tasks.py", line 1194, in plot_length_distributions
sns.distplot(lns)
File "/oak/stanford/groups/quake/mswift/resources/miniconda3/lib/python3.6/site-packages/seaborn/distributions.py", line 231, in distplot
kdeplot(a, vertical=vertical, ax=ax, color=kde_color, **kde_kws)
File "/oak/stanford/groups/quake/mswift/resources/miniconda3/lib/python3.6/site-packages/seaborn/distributions.py", line 691, in kdeplot
cumulative=cumulative, **kwargs)
File "/oak/stanford/groups/quake/mswift/resources/miniconda3/lib/python3.6/site-packages/seaborn/distributions.py", line 294, in _univariate_kdeplot
x, y = _scipy_univariate_kde(data, bw, gridsize, cut, clip)
File "/oak/stanford/groups/quake/mswift/resources/miniconda3/lib/python3.6/site-packages/seaborn/distributions.py", line 366, in _scipy_univariate_kde
kde = stats.gaussian_kde(data, bw_method=bw)
File "/home/users/mswift2/.local/lib/python3.6/site-packages/scipy/stats/kde.py", line 172, in init
self.set_bandwidth(bw_method=bw_method)
File "/home/users/mswift2/.local/lib/python3.6/site-packages/scipy/stats/kde.py", line 499, in set_bandwidth
self._compute_covariance()
File "/home/users/mswift2/.local/lib/python3.6/site-packages/scipy/stats/kde.py", line 510, in _compute_covariance
self._data_inv_cov = linalg.inv(self._data_covariance)
File "/home/users/mswift2/.local/lib/python3.6/site-packages/scipy/linalg/basic.py", line 975, in inv
raise LinAlgError("singular matrix")
numpy.linalg.linalg.LinAlgError: singular matrix

seemed like a non-critical portion of the program so I commented the lines out:
for l in loci: q = quartiles[l] lns = lengths[l] print(lns) if len(lns) > 1: print("length >1") pass #plt.figure() #plt.axvline(q[0], linestyle="--", color='k') #plt.axvline(q[1], linestyle="--", color='k') #sns.distplot(lns) sns. #sns.despine() #plt.xlabel("BCR_{} reconstructed length (bp)".format(l)) #plt.ylabel("Density") #plt.savefig("{}_{}.pdf".format(length_filename_root, l)) if len(lns) > 0: with open("{}_{}.txt".format(length_filename_root,l), 'w') as f: for l in sorted(lns): f.write("{}\n".format(l))

The program then unceremoniously ends right after the MakeDB step. I when I look at the expected results compared to the test results, the IGHG sequence is missing from the output the test generates.

Hopefully you can help!

Thanks,
Michael

Custom databases

I'm trying to use bracer with a custom gene database (which is actually a superset of the standard IMGT database). After the documentation issues in #31, I did include a database and created a gapped alignment that conforms to the IMGT standard, which at least lets me run bracer assemble without a crash. However, my heavy chains are getting lost somewhere in the mix. I can detect them with the standard Human database. Moreover, when I look at the output from the individual steps, I can see roughly the same hits from the Bowtie alignment, Trinity assembly, and constant region BLAST. However, the heavy chains are failing to "pass" the IgBLAST step. It looks like it's having trouble detecting CDR3 and J, so maybe this is a problem with the way I built the combinatorial_recombinomes?

Installation help. Get ~/.bracerrc set up and AssertionError on test.

Here's my conda environment:

(bracer_env) -bash-4.2$ conda list
# packages in environment at /usr/local/devel/ANNOTATION/jespinoz/anaconda3/envs/bracer_env:
#
# Name                    Version                   Build  Channel
_libgcc_mutex             0.1                 conda_forge    conda-forge
_openmp_mutex             4.5                       1_gnu    conda-forge
_r-mutex                  1.0.1               anacondar_1    conda-forge
airr                      1.3.1                    pypi_0    pypi
atk-1.0                   2.36.0               h3371d22_4    conda-forge
binutils_impl_linux-64    2.36.1               h193b22a_2    conda-forge
binutils_linux-64         2.36                 hf3e587d_2    conda-forge
biopython                 1.79                     pypi_0    pypi
blas                      1.1                    openblas    conda-forge
blast                     2.12.0          pl5262h3289130_0    bioconda
bowtie2                   2.3.5.1          py36he513fc3_0    bioconda
bracer                    0.1                      pypi_0    pypi
bwidget                   1.9.14               ha770c72_1    conda-forge
bz2file                   0.98                       py_0    conda-forge
bzip2                     1.0.8                h7f98852_4    conda-forge
c-ares                    1.18.1               h7f98852_0    conda-forge
ca-certificates           2021.10.8            ha878542_0    conda-forge
cairo                     1.16.0            ha00ac49_1009    conda-forge
changeo                   1.2.0                    pypi_0    pypi
collectl                  4.0.4                         2    bioconda
curl                      7.80.0               h2574ce0_0    conda-forge
cutadapt                  3.5                      pypi_0    pypi
cycler                    0.11.0                   pypi_0    pypi
dataclasses               0.8                      pypi_0    pypi
decorator                 5.1.0                    pypi_0    pypi
dnaio                     0.6.0                    pypi_0    pypi
entrez-direct             16.2                 he881be0_0    bioconda
expat                     2.4.2                h9c3ff4c_0    conda-forge
fastool                   0.1.4                h5bf99c6_5    bioconda
fastqc                    0.11.9               hdfd78af_1    bioconda
font-ttf-dejavu-sans-mono 2.37                 hab24e00_0    conda-forge
font-ttf-inconsolata      3.000                h77eed37_0    conda-forge
font-ttf-source-code-pro  2.038                h77eed37_0    conda-forge
font-ttf-ubuntu           0.83                 hab24e00_0    conda-forge
fontconfig                2.13.1            hba837de_1005    conda-forge
fonts-conda-ecosystem     1                             0    conda-forge
fonts-conda-forge         1                             0    conda-forge
freetype                  2.10.4               h0708190_1    conda-forge
fribidi                   1.0.10               h36c2ea0_0    conda-forge
future                    0.18.2                   pypi_0    pypi
gcc_impl_linux-64         9.4.0               h03d3576_11    conda-forge
gcc_linux-64              9.4.0                h391b98a_2    conda-forge
gdk-pixbuf                2.42.6               h04a7f16_0    conda-forge
gettext                   0.19.8.1          h73d1719_1008    conda-forge
gfortran_impl_linux-64    9.4.0               h0003116_11    conda-forge
gfortran_linux-64         9.4.0                hf0ab688_2    conda-forge
giflib                    5.2.1                h36c2ea0_2    conda-forge
graphite2                 1.3.13            h58526e2_1001    conda-forge
graphviz                  2.50.0               h85b4f2f_1    conda-forge
gsl                       2.7                  he838d99_0    conda-forge
gtk2                      2.24.33              h539f30e_1    conda-forge
gts                       0.7.6                h64030ff_2    conda-forge
gxx_impl_linux-64         9.4.0               h03d3576_11    conda-forge
gxx_linux-64              9.4.0                h0316aca_2    conda-forge
harfbuzz                  3.2.0                hb4a5f5f_0    conda-forge
hdf5                      1.10.6          nompi_h6a2412b_1114    conda-forge
htslib                    1.9                  h4da6232_3    bioconda
icu                       69.1                 h9c3ff4c_0    conda-forge
igblast                   1.17.1               h388d1fa_0    bioconda
importlib-metadata        4.8.3                    pypi_0    pypi
isal                      0.11.1                   pypi_0    pypi
java-jdk                  7.0.91                        1    bioconda
jbig                      2.1               h7f98852_2003    conda-forge
jellyfish                 2.2.10               h6bb024c_1    bioconda
jemalloc                  4.5.0                         0    bioconda
jpeg                      9d                   h36c2ea0_0    conda-forge
kallisto                  0.46.2               h60f4f9f_2    bioconda
kernel-headers_linux-64   2.6.32              he073ed8_15    conda-forge
kiwisolver                1.3.1                    pypi_0    pypi
krb5                      1.19.2               hcc1bbae_3    conda-forge
lcms2                     2.12                 hddcbb42_0    conda-forge
ld_impl_linux-64          2.36.1               hea4e1c9_2    conda-forge
lerc                      3.0                  h9c3ff4c_0    conda-forge
libblas                   3.9.0           1_h86c2bf4_netlib    conda-forge
libcblas                  3.9.0           5_h92ddd45_netlib    conda-forge
libcurl                   7.80.0               h2574ce0_0    conda-forge
libdeflate                1.8                  h7f98852_0    conda-forge
libedit                   3.1.20191231         he28a2e2_2    conda-forge
libev                     4.33                 h516909a_1    conda-forge
libffi                    3.4.2                h7f98852_5    conda-forge
libgcc                    7.2.0                h69d50b8_2    conda-forge
libgcc-devel_linux-64     9.4.0               hd854feb_11    conda-forge
libgcc-ng                 11.2.0              h1d223b6_11    conda-forge
libgd                     2.3.3                h3cfcdeb_1    conda-forge
libgfortran               3.0.0                         1    conda-forge
libgfortran-ng            11.2.0              h69a702a_11    conda-forge
libgfortran5              11.2.0              h5c6108e_11    conda-forge
libglib                   2.70.2               h174f98d_0    conda-forge
libgomp                   11.2.0              h1d223b6_11    conda-forge
libiconv                  1.16                 h516909a_0    conda-forge
liblapack                 3.9.0           5_h92ddd45_netlib    conda-forge
libnghttp2                1.43.0               h812cca2_1    conda-forge
libnsl                    2.0.0                h7f98852_0    conda-forge
libpng                    1.6.37               h21135ba_2    conda-forge
librsvg                   2.52.5               hc3c00ef_0    conda-forge
libsanitizer              9.4.0               h79bfe98_11    conda-forge
libssh2                   1.10.0               ha56f1ee_2    conda-forge
libstdcxx-devel_linux-64  9.4.0               hd854feb_11    conda-forge
libstdcxx-ng              11.2.0              he4da1e4_11    conda-forge
libtiff                   4.3.0                h6f004c6_2    conda-forge
libtool                   2.4.6             h9c3ff4c_1008    conda-forge
libuuid                   2.32.1            h7f98852_1000    conda-forge
libwebp                   1.2.1                h3452ae3_0    conda-forge
libwebp-base              1.2.1                h7f98852_0    conda-forge
libxcb                    1.13              h7f98852_1004    conda-forge
libxml2                   2.9.12               h885dcf4_1    conda-forge
libzlib                   1.2.11            h36c2ea0_1013    conda-forge
lz4-c                     1.9.3                h9c3ff4c_1    conda-forge
make                      4.3                  hd18ef5c_1    conda-forge
matplotlib                3.3.4                    pypi_0    pypi
mmtf-python               1.1.2                      py_0    conda-forge
mock                      4.0.3                    pypi_0    pypi
msgpack-python            1.0.2            py36hff7bd54_1
ncbi-vdb                  2.11.0               h1b792b2_1    bioconda
ncurses                   6.2                  h58526e2_4    conda-forge
networkx                  1.11                     pypi_0    pypi
numpy                     1.19.5                   pypi_0    pypi
olefile                   0.46               pyh9f0ad1d_1    conda-forge
openblas                  0.2.19                        2    conda-forge
openjdk                   10.0.2            h14c3975_1015    conda-forge
openssl                   1.1.1l               h7f98852_0    conda-forge
pandas                    0.24.2           py36hf484d3e_0    conda-forge
pango                     1.48.10              h54213e6_2    conda-forge
parafly                   r2013_01_21                   1    bioconda
patsy                     0.5.2              pyhd8ed1ab_0    conda-forge
pcre                      8.45                 h9c3ff4c_0    conda-forge
pcre2                     10.37                h032f7d1_0    conda-forge
perl                      5.26.2            h36c2ea0_1008    conda-forge
perl-archive-tar          2.32                    pl526_0    bioconda
perl-carp                 1.38                    pl526_3    bioconda
perl-common-sense         3.74                    pl526_2    bioconda
perl-compress-raw-bzip2   2.087           pl526he1b5a44_0    bioconda
perl-compress-raw-zlib    2.087           pl526hc9558a2_0    bioconda
perl-exporter             5.72                    pl526_1    bioconda
perl-exporter-tiny        1.002001                pl526_0    bioconda
perl-extutils-makemaker   7.36                    pl526_1    bioconda
perl-io-compress          2.087           pl526he1b5a44_0    bioconda
perl-io-zlib              1.10                    pl526_2    bioconda
perl-json                 4.02                    pl526_0    bioconda
perl-json-xs              2.34            pl526h6bb024c_3    bioconda
perl-list-moreutils       0.428                   pl526_1    bioconda
perl-list-moreutils-xs    0.428                   pl526_0    bioconda
perl-pathtools            3.75            pl526h14c3975_1    bioconda
perl-scalar-list-utils    1.52            pl526h516909a_0    bioconda
perl-threaded             5.26.0                        0    bioconda
perl-types-serialiser     1.0                     pl526_2    bioconda
perl-xsloader             0.24                    pl526_0    bioconda
phylip                    3.697                h470a237_0    bioconda
pigz                      2.6                  h27826a3_0    conda-forge
pillow                    8.4.0                    pypi_0    pypi
pip                       21.3.1             pyhd8ed1ab_0    conda-forge
pixman                    0.40.0               h36c2ea0_0    conda-forge
presto                    0.7.0                    pypi_0    pypi
prettytable               2.5.0                    pypi_0    pypi
pthread-stubs             0.4               h36c2ea0_1001    conda-forge
pydotplus                 2.0.2                    pypi_0    pypi
pyparsing                 3.0.6                    pypi_0    pypi
python                    3.6.15          hb7a2778_0_cpython    conda-forge
python-dateutil           2.8.2              pyhd8ed1ab_0    conda-forge
python-levenshtein        0.12.2                   pypi_0    pypi
python_abi                3.6                     2_cp36m    conda-forge
pytz                      2021.3             pyhd8ed1ab_0    conda-forge
pyyaml                    6.0                      pypi_0    pypi
r-ape                     5.5               r41h306847c_0    conda-forge
r-base                    4.1.2                hde4fec0_0    conda-forge
r-lattice                 0.20_45           r41hcfec24a_0    conda-forge
r-nlme                    3.1_153           r41h859d828_0    conda-forge
r-rcpp                    1.0.7             r41h03ef668_0    conda-forge
r-rphylip                 0.1_23          r41ha770c72_1003    conda-forge
readline                  8.1                  h46c0cb4_0    conda-forge
reportlab                 3.5.68           py36h3e18861_0    conda-forge
samtools                  1.7                           1    bioconda
scipy                     1.5.4                    pypi_0    pypi
seaborn                   0.11.2                   pypi_0    pypi
sed                       4.8                  he412f7d_0    conda-forge
setuptools                58.0.4           py36h5fab9bb_2    conda-forge
six                       1.16.0             pyh6c4a22f_0    conda-forge
slclust                   02022010                      2    bioconda
sqlite                    3.37.0               h9cd32fc_0    conda-forge
statsmodels               0.8.0                    py36_0    conda-forge
sysroot_linux-64          2.12                he073ed8_15    conda-forge
tbb                       2021.4.0             h4bd325d_1    conda-forge
tk                        8.6.11               h27826a3_1    conda-forge
tktable                   2.10                 hb7b940f_3    conda-forge
trim-galore               0.6.7                hdfd78af_0    bioconda
trimmomatic               0.39                 hdfd78af_2    bioconda
trinity                   2.1.1                         6    bioconda
typing-extensions         4.0.1                    pypi_0    pypi
wcwidth                   0.2.5                    pypi_0    pypi
wheel                     0.37.0             pyhd8ed1ab_1    conda-forge
xopen                     1.2.1                    pypi_0    pypi
xorg-kbproto              1.0.7             h7f98852_1002    conda-forge
xorg-libice               1.0.10               h7f98852_0    conda-forge
xorg-libsm                1.2.3             hd9c2040_1000    conda-forge
xorg-libx11               1.7.2                h7f98852_0    conda-forge
xorg-libxau               1.0.9                h7f98852_0    conda-forge
xorg-libxdmcp             1.1.3                h7f98852_0    conda-forge
xorg-libxext              1.3.4                h7f98852_1    conda-forge
xorg-libxrender           0.9.10            h7f98852_1003    conda-forge
xorg-libxt                1.2.1                h7f98852_2    conda-forge
xorg-renderproto          0.11.1            h7f98852_1002    conda-forge
xorg-xextproto            7.3.0             h7f98852_1002    conda-forge
xorg-xproto               7.0.31            h7f98852_1007    conda-forge
xz                        5.2.5                h516909a_1    conda-forge
yamlordereddictloader     0.4.0                    pypi_0    pypi
zipp                      3.6.0                    pypi_0    pypi
zlib                      1.2.11            h36c2ea0_1013    conda-forge
zstd                      1.5.0                ha95c52a_0    conda-forge

Here's my install directory:

(bracer_env) -bash-4.2$ ls
bracer.conf  bracer.egg-info  bracerlib  build  Dockerfile  docker_helper_files  LICENSE  lineage.R  README.md  requirements.txt  resources  setup.py  test_data

Here's what happens when I run test:

(bracer_env) -bash-4.2$ bracer test -p 4 -c bracer.conf
Please specify the path to where you originally installed BraCeR in the config file.
Please specify the path to where you originally installed BraCeR in the config file.
Traceback (most recent call last):
  File "/usr/local/devel/ANNOTATION/jespinoz/anaconda3/envs/bracer_env/bin/bracer", line 8, in <module>
    sys.exit(launch())
  File "/usr/local/devel/ANNOTATION/jespinoz/anaconda3/envs/bracer_env/lib/python3.6/site-packages/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/usr/local/devel/ANNOTATION/jespinoz/anaconda3/envs/bracer_env/lib/python3.6/site-packages/bracerlib/tasks.py", line 2008, in run
    trimmed_fastq2=self.trimmed_fastq2).run()
  File "/usr/local/devel/ANNOTATION/jespinoz/anaconda3/envs/bracer_env/lib/python3.6/site-packages/bracerlib/tasks.py", line 298, in __init__
    root=resource_dir)
  File "/usr/local/devel/ANNOTATION/jespinoz/anaconda3/envs/bracer_env/lib/python3.6/site-packages/bracerlib/tasks.py", line 184, in get_species_root
    assert os.path.isdir(resources_root), "Species not found in resources"
AssertionError: Species not found in resources

My current ~/.bracerrc file:

(bracer_env) -bash-4.2$ cat ~/.bracerrc
bracer_path=/usr/local/devel/ANNOTATION/jespinoz/Packages/bracer

What I need help with:

How do I set up my ~/.bracerrc file so it knows where the config is located?
How can I get the test to run?

No subdirectories generated after assemble step

Hi BraCeR team,

Thank you for the previous solutions which are work!

I use FASTQ file containing #1 and #2 mates from paired-end sequencing generated from 10x genomic system. This sample supposed to be detected 500+ cells +400 paired vdj through 10x’s software-cellranger vdj.

I got the following output which unlike test data contains 3 cells. Unsure whether I should
Set cell_name for 500+ cells that I won’t be able to know until BCR construction. Do you have any solution for this? Please let me know if you need more information!
Mac-Pro:outs patrickwilson$ cd ..
Mac-Pro:319vdj patrickwilson$ ls
319-VDJ_S11_L006_I1_001.fastq 319-VDJ_S11_L006_R1_001.fastq.gz outs
319-VDJ_S11_L006_I1_001.fastq.gz 319-VDJ_S11_L006_R2_001.fastq
319-VDJ_S11_L006_R1_001.fastq 319-VDJ_S11_L006_R2_001.fastq.gz
Mac-Pro:319vdj patrickwilson$ cd outs
Mac-Pro:outs patrickwilson$ pwd
/Users/patrickwilson/Desktop/linda/319vdj/outs
Mac-Pro:outs patrickwilson$ ls
319vdj
Mac-Pro:outs patrickwilson$ cd 319vdj/
Mac-Pro:319vdj patrickwilson$ ls
BLAST_output aligned_reads trimmed_reads
IgBLAST_output expression_quantification unfiltered_BCR_seqs
Trinity_output filtered_BCR_seqs
Mac-Pro:319vdj patrickwilson$

I put the last step showing on my end of assemble step for your reference.

##Running Kallisto##
##Making Kallisto indices##

[build] loading fasta file /scratch/outs/319vdj/expression_quantification/kallisto_index/319vdj_transcriptome.fa
[build] k-mer length: 31
[build] warning: clipped off poly-A tail (longer than 10)
from 1549 target sequences
[build] warning: replaced 4 non-ACGUT characters in the input sequence
with pseudorandom nucleotides
[build] counting k-mers ... done.
[build] building target de Bruijn graph ... done
[build] creating equivalence classes ... done
[build] target de Bruijn graph has 1285321 contigs and contains 126172909 k-mers

##Quantifying with Kallisto##

[quant] fragment length distribution will be estimated from the data
[index] k-mer length: 31
[index] number of targets: 200,371
[index] number of k-mers: 126,172,909
[index] number of equivalence classes: 825,477
[quant] running in paired-end mode
[quant] will process pair 1: /scratch/outs/319vdj/trimmed_reads/319-VDJ_S11_L006_R1_001_val_1.fq
/scratch/outs/319vdj/trimmed_reads/319-VDJ_S11_L006_R2_001_val_2.fq
[quant] finding pseudoalignments for the reads ... done
[quant] processed 6,016,781 reads, 2,008,887 reads pseudoaligned
[quant] estimated average fragment length: 182.116
[ em] quantifying the abundances ... done
[ em] the Expectation-Maximization algorithm ran for 648 rounds

Thank you,
Linda

Gencode Fasta link not available

Hello,

i am trying to download the fasta transcriptome from Gencode as suggested:

ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_human/release_27/gencode.v27.transcripts.fa.gz

Unfortunately the link is compromised. My question is: can I use another annotation or this can create probolems? I know that gencode and UCSC or ensembl use different chromsomes annotation (chr1 vs 1 for example..). Or, if you have such annotation could you please provide a link from which I can download it?

Thank you in advance for any reply.

Low alignment rate for healthy-donor b cells

Bowtie2 seems to return very low VDJ alignment rates for each of my B cells and virtually no VDJ sequences were able to be reconstructed (BCR_summary.txt screenshot linked below).

Because bracer was built using plasma cells (15-20% IGHV mutation) from intestinal tissue, I am surprised that my 2 sets of data yields little to no BCR info (considering that each cell was sequenced 1-2 mil clusters). Could you provide us with your insight on why this might be happening?

*** Full-length transcriptome data from healthy donor B cells was generated using the Takara smart-seq HT kit (2x150bp). A screenshot of the sequencing depth and HISAT2 alignment to hg38 are linked below as well.

Thank you for your time and looking forward to hearing your insights,
Alex

Running igblast --regions --scores options are not recognizes

Hello,

I have installed bracer in my local machine and I am trying the test

python bracer test -p 2 -c bracer.conf run

to see if everything worked fine.

After mapping and trinity assembly there is the step of blasting the assembled sequences. While running igblast, Bracer is running MakeDb.py, but it cannot recognize the options --regions --scores that I believe are included in bracer while running MakeDb.py. You can see the error below MakeDb.py: error: unrecognized arguments: --regions --scores:

usage: MakeDb.py [--version] [-h]  ...
MakeDb.py: error: unrecognized arguments: --regions --scores
Traceback (most recent call last):
  File "bracer", line 21, in <module>
    launch()
  File "/site/ne/home/i0439277/bracer/bracer-master/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/site/ne/home/i0439277/bracer/bracer-master/bracerlib/tasks.py", line 2008, in run
    trimmed_fastq2=self.trimmed_fastq2).run()
  File "/site/ne/home/i0439277/bracer/bracer-master/bracerlib/tasks.py", line 374, in run
    cell = self.ig_blast() # Run IgBlast
  File "/site/ne/home/i0439277/bracer/bracer-master/bracerlib/tasks.py", line 547, in ig_blast
    self.create_changeo_db()
  File "/site/ne/home/i0439277/bracer/bracer-master/bracerlib/tasks.py", line 581, in create_changeo_db
    ungapped_seq_location, self.cell_name)
  File "/site/ne/home/i0439277/bracer/bracer-master/bracerlib/bracer_func.py", line 2234, in run_MakeDb_for_cell
    subprocess.check_call(command)
  File "/site/ne/home/i0439277/anaconda3/envs/bracer_env/lib/python3.7/subprocess.py", line 363, in check_call
    raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command '['MakeDb.py', 'igblast', '-i', '/site/ne/home/i0439277/bracer/bracer-master/test_data/results/cell1/IgBLAST_output/cell1_BCR_K.fmt7', '-s', '/site/ne/home/i0439277/bracer/bracer-master/test_data/results/cell1/Trinity_output/cell1_BCR_K.Trinity.fasta', '-r', '/site/ne/home/i0439277/bracer/bracer-master/resources/Hsap/imgt_gapped_resources/raw_seqs/BCR_K_V.fa', '/site/ne/home/i0439277/bracer/bracer-master/resources/Hsap/raw_seqs/BCR_H_D.fa', '/site/ne/home/i0439277/bracer/bracer-master/resources/Hsap/raw_seqs/BCR_K_J.fa', '--regions', '--scores']' returned non-zero exit status 2.

If I run the same command removing --regions --scores it works:

 MakeDb.py igblast -i /site/ne/home/i0439277/bracer/bracer-master/test_data/results/cell1/IgBLAST_output/cell1_BCR_K.fmt7 -s /site/ne/home/i0439277/bracer/bracer-master/test_data/results/cell1/Trinity_output/cell1_BCR_K.Trinity.fasta -r /site/ne/home/i0439277/bracer/bracer-master/resources/Hsap/imgt_gapped_resources/raw_seqs/BCR_K_V.fa /site/ne/home/i0439277/bracer/bracer-master/resources/Hsap/raw_seqs/BCR_H_D.fa /site/ne/home/i0439277/bracer/bracer-master/resources/Hsap/raw_seqs/BCR_K_J.fa
       START> MakeDB
     ALIGNER> IgBLAST
ALIGNER_FILE> cell1_BCR_K.fmt7
    SEQ_FILE> cell1_BCR_K.Trinity.fasta
     ASIS_ID> False
  ASIS_CALLS> False
     PARTIAL> False
    EXTENDED> False

PROGRESS> 09:34:38 |Done                | 0.0 min

PROGRESS> 09:34:38 |####################| 100% (1) 0.0 min

OUTPUT> cell1_BCR_K_db-pass.tab
  PASS> 1
  FAIL> 0
   END> MakeDb

Has anyone encountered the same issue? How can avoid it? Thank you for any feedback. I am open to modify that part in the software.

getting transcriptome files from gencode code broken link

From the installation instructions:
mkdir GRCh38 && cd GRCh38 && wget ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_human/release_27/gencode.v27.transcripts.fa.gz && \ gunzip gencode.v27.transcripts.fa.gz && python3 /path/to/bracer/docker_helper_files/gencode_parse.py gencode.v27.trans

Yields
--2018-12-17 14:30:40-- ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_human/release_27/gencode.v27.transcripts.fa.gz
=> ‘gencode.v27.transcripts.fa.gz’
Resolving ftp.sanger.ac.uk (ftp.sanger.ac.uk)... 193.62.203.115
Connecting to ftp.sanger.ac.uk (ftp.sanger.ac.uk)|193.62.203.115|:21... connected.
Logging in as anonymous ... Logged in!
==> SYST ... done. ==> PWD ... done.
==> TYPE I ... done. ==> CWD (1) /pub/gencode/Gencode_human/release_27 ...
No such directory ‘pub/gencode/Gencode_human/release_27’

Testing - CI?

Is there interest in setting up continuous integration for testing BraCeR output? Travis builds can run Docker images, for example, which would make implementation easier. As a first step testing could be limited to the assemble command and take advantage of the existing test data. I would be happy to take a first pass.

UnicodeDecodeError

Hello there,

I'm trying to install your program on one of our servers and I'm getting some sort of Python errors linked to the character encoding. Everything seems to work fine until the Kallisto step. Here's the error message I'm getting.

/Programs/bracer/bracer test --ncores 12 --config_file /Programs/bracer/bracer.conf
====
##Making Kallisto indices##
Traceback (most recent call last):
File "/Programs/bracer/bracer", line 21, in
launch()
File "/Programs/bracer/bracerlib/launcher.py", line 43, in launch
Task().run()
File "/Programs/bracer/bracerlib/tasks.py", line 1937, in run
trimmed_fastq2=self.trimmed_fastq2).run()
File "/Programs/bracer/bracerlib/tasks.py", line 369, in run
self.quantify(cell)
File "/Programs/bracer/bracerlib/tasks.py", line 605, in quantify
self.trimmed_fastq2, self.keep_trimmed_reads)
File "/Programs/bracer/bracerlib/bracer_func.py", line 2103, in quantify_with_kallisto
for line in infile:
File "/home/apps/Logiciels/Python/python-3.5.1/lib/python3.5/encodings/ascii.py", line 26, in decode
return codecs.ascii_decode(input, self.errors)[0]
UnicodeDecodeError: 'ascii' codec can't decode byte 0xc8 in position 32: ordinal not in range(128)

====

I tried different fixes in the bracer_func_py file at line 2104 like to change the
line variable encoding using this:
line=line.decode('latin1').encode('ascii','replace')

It seems that it's bugging before this line anyway. Do you have any idea of what's going on?

Thanks a lot for your help!

Jean-Christophe

How to get the nice clonal network graph as in Nat.Methods publication?

Hi,
I run bracer summarise with default settings (summarise --graph_format pdf), but it seems I can't get the same graph layout for the clonal network as the one you show in Fig1A of the Nat.Methods publication (and in Supp.Figure SN7.1/2).
The problem with my graph is that all the circles (== clonotypes) are allineated and not scattered around as in Fig1. Also, I don't get any legend for Ig subtypes and productive/unproductive chains.

Is there a special option I need to set to get the same output? Or did you actually modified the output with another program (like Illustrator) to get it in the nice layout of the publication?

Thank youfor the attention!
BW
Sabrina

[Feature Request] Update the Biopython dependency

Here's my conda environment:

(bracer_env) -bash-4.2$ conda list
# packages in environment at /usr/local/devel/ANNOTATION/jespinoz/anaconda3/envs/bracer_env:
#
# Name                    Version                   Build  Channel
_libgcc_mutex             0.1                 conda_forge    conda-forge
_openmp_mutex             4.5                       1_gnu    conda-forge
_r-mutex                  1.0.1               anacondar_1    conda-forge
airr                      1.3.1                    pypi_0    pypi
alsa-lib                  1.2.3                h516909a_0    conda-forge
atk-1.0                   2.36.0               h3371d22_4    conda-forge
binutils_impl_linux-64    2.36.1               h193b22a_2    conda-forge
binutils_linux-64         2.36                 hf3e587d_2    conda-forge
biopython                 1.79             py36h8f6f2f9_0    conda-forge
blast                     2.12.0          pl5262h3289130_0    bioconda
boost-cpp                 1.74.0               h312852a_4    conda-forge
bowtie                    1.3.1            py36hc7b4e84_0    bioconda
bowtie2                   2.3.5.1          py36he513fc3_0    bioconda
bracer                    0.1                      pypi_0    pypi
bwidget                   1.9.14               ha770c72_1    conda-forge
bz2file                   0.98                       py_0    conda-forge
bzip2                     1.0.8                h7f98852_4    conda-forge
c-ares                    1.18.1               h7f98852_0    conda-forge
ca-certificates           2021.10.8            ha878542_0    conda-forge
cairo                     1.16.0            h6cf1ce9_1008    conda-forge
certifi                   2021.5.30        py36h5fab9bb_0    conda-forge
changeo                   1.2.0                    pypi_0    pypi
curl                      7.80.0               h2574ce0_0    conda-forge
cutadapt                  3.5                      pypi_0    pypi
cycler                    0.11.0             pyhd8ed1ab_0    conda-forge
dataclasses               0.8                      pypi_0    pypi
decorator                 5.1.0                    pypi_0    pypi
dnaio                     0.6.0                    pypi_0    pypi
entrez-direct             16.2                 he881be0_0    bioconda
expat                     2.4.2                h9c3ff4c_0    conda-forge
fastqc                    0.11.9               hdfd78af_1    bioconda
font-ttf-dejavu-sans-mono 2.37                 hab24e00_0    conda-forge
font-ttf-inconsolata      3.000                h77eed37_0    conda-forge
font-ttf-source-code-pro  2.038                h77eed37_0    conda-forge
font-ttf-ubuntu           0.83                 hab24e00_0    conda-forge
fontconfig                2.13.1            hba837de_1005    conda-forge
fonts-conda-ecosystem     1                             0    conda-forge
fonts-conda-forge         1                             0    conda-forge
freetype                  2.10.4               h0708190_1    conda-forge
fribidi                   1.0.10               h36c2ea0_0    conda-forge
future                    0.18.2                   pypi_0    pypi
gcc_impl_linux-64         9.4.0               h03d3576_11    conda-forge
gcc_linux-64              9.4.0                h391b98a_2    conda-forge
gdk-pixbuf                2.42.6               h04a7f16_0    conda-forge
gettext                   0.19.8.1          h73d1719_1008    conda-forge
gfortran_impl_linux-64    9.4.0               h0003116_11    conda-forge
gfortran_linux-64         9.4.0                hf0ab688_2    conda-forge
giflib                    5.2.1                h36c2ea0_2    conda-forge
graphite2                 1.3.13            h58526e2_1001    conda-forge
graphviz                  2.50.0               h85b4f2f_1    conda-forge
gsl                       2.7                  he838d99_0    conda-forge
gtk2                      2.24.33              h539f30e_1    conda-forge
gts                       0.7.6                h64030ff_2    conda-forge
gxx_impl_linux-64         9.4.0               h03d3576_11    conda-forge
gxx_linux-64              9.4.0                h0316aca_2    conda-forge
harfbuzz                  2.9.1                h83ec7ef_1    conda-forge
hdf5                      1.10.6          nompi_h6a2412b_1114    conda-forge
htslib                    1.14                 h9093b5e_0    bioconda
icu                       68.2                 h9c3ff4c_0    conda-forge
igblast                   1.17.1               h388d1fa_0    bioconda
importlib-metadata        4.8.3                    pypi_0    pypi
isal                      0.11.1                   pypi_0    pypi
jbig                      2.1               h7f98852_2003    conda-forge
jpeg                      9d                   h36c2ea0_0    conda-forge
kallisto                  0.46.2               h60f4f9f_2    bioconda
kernel-headers_linux-64   2.6.32              he073ed8_15    conda-forge
kiwisolver                1.3.1            py36h605e78d_1    conda-forge
kmer-jellyfish            2.3.0                h7d875b9_2    bioconda
krb5                      1.19.2               hcc1bbae_3    conda-forge
lcms2                     2.12                 hddcbb42_0    conda-forge
ld_impl_linux-64          2.36.1               hea4e1c9_2    conda-forge
lerc                      2.2.1                h9c3ff4c_0    conda-forge
libblas                   3.9.0           12_linux64_openblas    conda-forge
libcblas                  3.9.0           12_linux64_openblas    conda-forge
libcurl                   7.80.0               h2574ce0_0    conda-forge
libdeflate                1.7                  h7f98852_5    conda-forge
libedit                   3.1.20191231         he28a2e2_2    conda-forge
libev                     4.33                 h516909a_1    conda-forge
libffi                    3.4.2                h7f98852_5    conda-forge
libgcc-devel_linux-64     9.4.0               hd854feb_11    conda-forge
libgcc-ng                 11.2.0              h1d223b6_11    conda-forge
libgd                     2.3.3                h6ad9fb6_0    conda-forge
libgfortran-ng            11.2.0              h69a702a_11    conda-forge
libgfortran5              11.2.0              h5c6108e_11    conda-forge
libglib                   2.70.2               h174f98d_0    conda-forge
libgomp                   11.2.0              h1d223b6_11    conda-forge
libiconv                  1.16                 h516909a_0    conda-forge
libjemalloc               5.2.1                h9c3ff4c_6    conda-forge
liblapack                 3.9.0           12_linux64_openblas    conda-forge
libnghttp2                1.43.0               h812cca2_1    conda-forge
libnsl                    2.0.0                h7f98852_0    conda-forge
libopenblas               0.3.18          pthreads_h8fe5266_0    conda-forge
libpng                    1.6.37               h21135ba_2    conda-forge
librsvg                   2.52.5               hc3c00ef_0    conda-forge
libsanitizer              9.4.0               h79bfe98_11    conda-forge
libssh2                   1.10.0               ha56f1ee_2    conda-forge
libstdcxx-devel_linux-64  9.4.0               hd854feb_11    conda-forge
libstdcxx-ng              11.2.0              he4da1e4_11    conda-forge
libtiff                   4.3.0                hf544144_1    conda-forge
libtool                   2.4.6             h9c3ff4c_1008    conda-forge
libuuid                   2.32.1            h7f98852_1000    conda-forge
libwebp                   1.2.1                h3452ae3_0    conda-forge
libwebp-base              1.2.1                h7f98852_0    conda-forge
libxcb                    1.13              h7f98852_1004    conda-forge
libxml2                   2.9.12               h72842e0_0    conda-forge
libzlib                   1.2.11            h36c2ea0_1013    conda-forge
lz4-c                     1.9.3                h9c3ff4c_1    conda-forge
make                      4.3                  hd18ef5c_1    conda-forge
matplotlib                3.3.4                    pypi_0    pypi
matplotlib-base           3.3.2            py36he12231b_1    conda-forge
mock                      4.0.3                    pypi_0    pypi
ncbi-vdb                  2.11.0               h1b792b2_1    bioconda
ncurses                   6.2                  h58526e2_4    conda-forge
networkx                  1.11                     pypi_0    pypi
numpy                     1.19.5           py36hfc0c790_2    conda-forge
olefile                   0.46               pyh9f0ad1d_1    conda-forge
openjdk                   11.0.9.1             h5cc2fde_1    conda-forge
openssl                   1.1.1l               h7f98852_0    conda-forge
pandas                    1.1.5            py36h284efc9_0    conda-forge
pango                     1.48.10              hb8ff022_1    conda-forge
patsy                     0.5.2              pyhd8ed1ab_0    conda-forge
pcre                      8.45                 h9c3ff4c_0    conda-forge
pcre2                     10.37                h032f7d1_0    conda-forge
perl                      5.26.2            h36c2ea0_1008    conda-forge
perl-archive-tar          2.32                    pl526_0    bioconda
perl-carp                 1.38                    pl526_3    bioconda
perl-common-sense         3.74                    pl526_2    bioconda
perl-compress-raw-bzip2   2.087           pl526he1b5a44_0    bioconda
perl-compress-raw-zlib    2.087           pl526hc9558a2_0    bioconda
perl-exporter             5.72                    pl526_1    bioconda
perl-exporter-tiny        1.002001                pl526_0    bioconda
perl-extutils-makemaker   7.36                    pl526_1    bioconda
perl-io-compress          2.087           pl526he1b5a44_0    bioconda
perl-io-zlib              1.10                    pl526_2    bioconda
perl-json                 4.02                    pl526_0    bioconda
perl-json-xs              2.34            pl526h6bb024c_3    bioconda
perl-list-moreutils       0.428                   pl526_1    bioconda
perl-list-moreutils-xs    0.428                   pl526_0    bioconda
perl-pathtools            3.75            pl526h14c3975_1    bioconda
perl-scalar-list-utils    1.52            pl526h516909a_0    bioconda
perl-types-serialiser     1.0                     pl526_2    bioconda
perl-xsloader             0.24                    pl526_0    bioconda
phylip                    3.697                h470a237_0    bioconda
pigz                      2.6                  h27826a3_0    conda-forge
pillow                    8.4.0                    pypi_0    pypi
pip                       21.3.1             pyhd8ed1ab_0    conda-forge
pixman                    0.40.0               h36c2ea0_0    conda-forge
presto                    0.7.0                    pypi_0    pypi
prettytable               2.5.0                    pypi_0    pypi
pthread-stubs             0.4               h36c2ea0_1001    conda-forge
pydotplus                 2.0.2                    pypi_0    pypi
pyparsing                 3.0.6              pyhd8ed1ab_0    conda-forge
python                    3.6.15          hb7a2778_0_cpython    conda-forge
python-dateutil           2.8.2              pyhd8ed1ab_0    conda-forge
python-levenshtein        0.12.2                   pypi_0    pypi
python_abi                3.6                     2_cp36m    conda-forge
pytz                      2021.3             pyhd8ed1ab_0    conda-forge
pyyaml                    6.0                      pypi_0    pypi
r-ape                     5.6               r40h306847c_0    conda-forge
r-base                    4.0.5                hb93adac_3    conda-forge
r-lattice                 0.20_45           r40hcfec24a_0    conda-forge
r-nlme                    3.1_153           r40h859d828_0    conda-forge
r-rcpp                    1.0.7             r40h03ef668_0    conda-forge
r-rphylip                 0.1_23          r40ha770c72_1003    conda-forge
readline                  8.1                  h46c0cb4_0    conda-forge
salmon                    1.6.0                h84f40af_0    bioconda
samtools                  1.14                 hb421002_0    bioconda
scipy                     1.5.4                    pypi_0    pypi
seaborn                   0.11.2                   pypi_0    pypi
sed                       4.8                  he412f7d_0    conda-forge
setuptools                58.0.4           py36h5fab9bb_2    conda-forge
six                       1.16.0             pyh6c4a22f_0    conda-forge
sqlite                    3.37.0               h9cd32fc_0    conda-forge
statsmodels               0.12.1           py36h92226af_2    conda-forge
sysroot_linux-64          2.12                he073ed8_15    conda-forge
tbb                       2020.2               h4bd325d_4    conda-forge
tk                        8.6.11               h27826a3_1    conda-forge
tktable                   2.10                 hb7b940f_3    conda-forge
tornado                   6.1              py36h8f6f2f9_1    conda-forge
trim-galore               0.6.7                hdfd78af_0    bioconda
trimmomatic               0.39                 hdfd78af_2    bioconda
trinity                   2.8.5                h8b12597_3    bioconda
typing-extensions         4.0.1                    pypi_0    pypi
wcwidth                   0.2.5                    pypi_0    pypi
wheel                     0.37.0             pyhd8ed1ab_1    conda-forge
xopen                     1.2.1                    pypi_0    pypi
xorg-fixesproto           5.0               h7f98852_1002    conda-forge
xorg-inputproto           2.3.2             h7f98852_1002    conda-forge
xorg-kbproto              1.0.7             h7f98852_1002    conda-forge
xorg-libice               1.0.10               h7f98852_0    conda-forge
xorg-libsm                1.2.3             hd9c2040_1000    conda-forge
xorg-libx11               1.7.2                h7f98852_0    conda-forge
xorg-libxau               1.0.9                h7f98852_0    conda-forge
xorg-libxdmcp             1.1.3                h7f98852_0    conda-forge
xorg-libxext              1.3.4                h7f98852_1    conda-forge
xorg-libxfixes            5.0.3             h7f98852_1004    conda-forge
xorg-libxi                1.7.10               h7f98852_0    conda-forge
xorg-libxrender           0.9.10            h7f98852_1003    conda-forge
xorg-libxt                1.2.1                h7f98852_2    conda-forge
xorg-libxtst              1.2.3             h7f98852_1002    conda-forge
xorg-recordproto          1.14.2            h7f98852_1002    conda-forge
xorg-renderproto          0.11.1            h7f98852_1002    conda-forge
xorg-xextproto            7.3.0             h7f98852_1002    conda-forge
xorg-xproto               7.0.31            h7f98852_1007    conda-forge
xz                        5.2.5                h516909a_1    conda-forge
yamlordereddictloader     0.4.0                    pypi_0    pypi
zipp                      3.6.0                    pypi_0    pypi
zlib                      1.2.11            h36c2ea0_1013    conda-forge
zstd                      1.5.0                ha95c52a_0    conda-forge

It looks like a few hacks are needed to get this software to run w/ old biopython and numpy versions.

Is there anything in the works for updating the dependencies and/or creating a conda environment that has everything configured? Having difficulty getting all of the versions to play nice.

Memory requirements in Summarise

Hi,

I attempted doing the suggested workflow on 10X Genomics data described on #21 . The program works well up to the assembly stage, but we have problems during the summarise stage.

I ran summarise with relatively common arguments ( -p 8 --graph_format pdf --infer_lineage), but:

changeodb.tab, IMGT_gapped.tab, reconstructed_lengths_BCR[H|K|L].pdf, reconstructed_lengths_BCR[H|K|L].txt, full_length_seqs.pdf, changeo_input_[H|K|L]_clone-pass.tab and isotype_distribution.pdf were successfully generated nearly immediately. However, clonotype_network_[with|without]_identifiers.dot took at least 8 hours to generate. Halting the script during this period shows the time was spent running make_cell_network_from_dna, Especially on line 1094-1095 of bracer_func.py.
I'm under the impression that this step spent an abnormal amount of memory. When I assigned a Grid Engine job with 8 cores and 176GB of memory, the job quitted due to memory over-usage.

The data set includes 4,275 barcodes, that I don't believe to be particularly many. Are there any thing I can do with it?

bracer summarize output description

It will be helpful to have a description of the columns in IMGT_gapped_db.tab output by bracer summarize. Is it possible to include this in the readme?

run test_data failed

Hi bracer team,

I set up bracer through downloading the docker image directly, but ran error with test data as following. Do you have any suggestions for it?

Lindas-MacBook-Pro:test_data lindalan$ docker run -it --rm -v $PWD:/scratch -w /scratch teichlab/bracer assemble -p 4 cell1 /scratch/out_test2 /scratch/cell1_1.fastq /scratch/cell1_2.fastq

##Trimming raw reads##
Detecting installed version of Cutadapt:
1.14
Trimming completed
##Finding recombinant-derived reads##
Attempting new assembly for ['BCR_H', 'BCR_K', 'BCR_L']

Detected average R1 read length:
50.0
Short read length detected. BraCeR will run two rounds of alignment for heavy chain

##BCR_H##
56433 reads; of these:
56433 (100.00%) were paired; of these:
34987 (62.00%) aligned concordantly 0 times
21446 (38.00%) aligned concordantly exactly 1 time
0 (0.00%) aligned concordantly >1 times
----
34987 pairs aligned concordantly 0 times; of these:
76 (0.22%) aligned discordantly 1 time
----
34911 pairs aligned 0 times concordantly or discordantly; of these:
69822 mates make up the pairs; of these:
69305 (99.26%) aligned 0 times
248 (0.36%) aligned exactly 1 time
269 (0.39%) aligned >1 times
38.60% overall alignment rate
56433 reads; of these:
56433 (100.00%) were paired; of these:
55425 (98.21%) aligned concordantly 0 times
1008 (1.79%) aligned concordantly exactly 1 time
0 (0.00%) aligned concordantly >1 times
----
55425 pairs aligned concordantly 0 times; of these:
20563 (37.10%) aligned discordantly 1 time
----
34862 pairs aligned 0 times concordantly or discordantly; of these:
69724 mates make up the pairs; of these:
69316 (99.41%) aligned 0 times
379 (0.54%) aligned exactly 1 time
29 (0.04%) aligned >1 times
38.59% overall alignment rate
##BCR_K##
56433 reads; of these:
56433 (100.00%) were paired; of these:
48166 (85.35%) aligned concordantly 0 times
8267 (14.65%) aligned concordantly exactly 1 time
0 (0.00%) aligned concordantly >1 times
----
48166 pairs aligned concordantly 0 times; of these:
112 (0.23%) aligned discordantly 1 time
----
48054 pairs aligned 0 times concordantly or discordantly; of these:
96108 mates make up the pairs; of these:
95668 (99.54%) aligned 0 times
187 (0.19%) aligned exactly 1 time
253 (0.26%) aligned >1 times
15.24% overall alignment rate
##BCR_L##
56433 reads; of these:
56433 (100.00%) were paired; of these:
31447 (55.72%) aligned concordantly 0 times
24986 (44.28%) aligned concordantly exactly 1 time
0 (0.00%) aligned concordantly >1 times
----
31447 pairs aligned concordantly 0 times; of these:
268 (0.85%) aligned discordantly 1 time
----
31179 pairs aligned 0 times concordantly or discordantly; of these:
62358 mates make up the pairs; of these:
61680 (98.91%) aligned 0 times
134 (0.21%) aligned exactly 1 time
544 (0.87%) aligned >1 times
45.35% overall alignment rate

##Assembling Trinity Contigs##
##BCR_H##
Left read files: $VAR1 = [
'/scratch/out_test2/cell1/aligned_reads/cell1_BCR_H_1.fastq'
];
Right read files: $VAR1 = [
'/scratch/out_test2/cell1/aligned_reads/cell1_BCR_H_2.fastq'
];
Trinity version: Trinity-v2.4.0
** NOTE: Latest version of Trinity is Trinity-v2.7.0-PRERELEASE, and can be obtained at:
https://github.com/trinityrnaseq/trinityrnaseq/releases

Wednesday, August 8, 2018: 23:45:43 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/ExitTester.jar 0
Wednesday, August 8, 2018: 23:45:44 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/ExitTester.jar 1
Wednesday, August 8, 2018: 23:45:44 CMD: mkdir -p /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H
Wednesday, August 8, 2018: 23:45:44 CMD: mkdir -p /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis

-------------- Trinity Phase 1: Clustering of RNA-Seq Reads ---------------------

Converting input files. (in parallel)Wednesday, August 8, 2018: 23:45:44 CMD: cat /scratch/out_test2/cell1/aligned_reads/cell1_BCR_H_1.fastq | seqtk-trinity seq -A - >> left.fa
Wednesday, August 8, 2018: 23:45:44 CMD: cat /scratch/out_test2/cell1/aligned_reads/cell1_BCR_H_2.fastq | seqtk-trinity seq -A - >> right.fa
Wednesday, August 8, 2018: 23:45:44 CMD: touch right.fa.ok
Wednesday, August 8, 2018: 23:45:44 CMD: touch left.fa.ok
Wednesday, August 8, 2018: 23:45:44 CMD: touch left.fa.ok right.fa.ok
Wednesday, August 8, 2018: 23:45:44 CMD: cat left.fa right.fa > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa
Wednesday, August 8, 2018: 23:45:44 CMD: touch /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa.ok

----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --

Running CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/jellyfish/bin/jellyfish count -t 4 -m 25 -s 100000000 --canonical /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa
Running CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/jellyfish/bin/jellyfish dump -L 1 mer_counts.jf > jellyfish.kmers.fa
Running CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/jellyfish/bin/jellyfish histo -t 4 -o jellyfish.kmers.fa.histo mer_counts.jf

--------------- Inchworm ---------------------
-- (Linear contig construction from k-mers) --

Running CMD: /trinityrnaseq-Trinity-v2.4.0/Inchworm/bin//inchworm --kmers jellyfish.kmers.fa --run_inchworm -K 25 -L 25 --monitor 1 --DS --num_threads 4 --PARALLEL_IWORM > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa.tmp
Running CMD: mv /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa.tmp /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa
Wednesday, August 8, 2018: 23:45:46 CMD: touch /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa.finished

-------------------- Chrysalis -------------------------
-- (Contig Clustering & de Bruijn Graph Construction) --

inchworm_target: /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa
bowite_reads_fa: /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa
chrysalis_reads_fa: /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa

Running CMD: /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/filter_iworm_by_min_length_or_cov.pl /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa 100 10 > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/inchworm.K25.L25.DS.fa.min100
Running CMD: bowtie2-build -o 3 /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/inchworm.K25.L25.DS.fa.min100 /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/inchworm.K25.L25.DS.fa.min100 1>/dev/null
Running CMD: bash -c " set -o pipefail;bowtie2 --local -k 2 --threads 4 -f --score-min G,46,0 -x /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/inchworm.K25.L25.DS.fa.min100 /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa | samtools view -@ 4 -F4 -Sb - | samtools sort -m 134217728 -@ 4 -no - - > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/iworm.bowtie.nameSorted.bam"
Running CMD: /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/scaffold_iworm_contigs.pl /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/iworm.bowtie.nameSorted.bam /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/iworm_scaffolds.txt
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/GraphFromFasta -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa -r /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa -min_contig_length 200 -min_glue 2 -glue_factor 0.05 -min_iso_ratio 0.05 -t 4 -k 24 -kk 48 > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/iworm_cluster_welds_graph.txt
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/BubbleUpClustering -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/inchworm.K25.L25.DS.fa -weld_graph /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/iworm_cluster_welds_graph.txt -min_contig_length 200 > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/GraphFromIwormFasta.out
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/CreateIwormFastaBundle -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/GraphFromIwormFasta.out -o /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/bundled_iworm_contigs.fasta -min 200
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/ReadsToTranscripts -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/both.fa -f /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/bundled_iworm_contigs.fasta -o /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/readsToComponents.out -t 4 -max_mem_reads 50000000
Running CMD: /usr/bin/sort --parallel=4 -T . -S 1G -k 1,1n /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/readsToComponents.out > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis/readsToComponents.out.sort
Wednesday, August 8, 2018: 23:45:48 CMD: mkdir -p read_partitions/Fb_0/CBin_0
Wednesday, August 8, 2018: 23:45:49 CMD: touch partitioned_reads.files.list.ok
Wednesday, August 8, 2018: 23:45:49 CMD: /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/write_partitioned_trinity_cmds.pl --reads_list_file partitioned_reads.files.list --CPU 1 --max_memory 1G --run_as_paired --seqType fa --trinity_complete --full_cleanup > recursive_trinity.cmds
Wednesday, August 8, 2018: 23:45:49 CMD: touch recursive_trinity.cmds.ok
Wednesday, August 8, 2018: 23:45:49 CMD: touch recursive_trinity.cmds.ok

------------ Trinity Phase 2: Assembling Clusters of Reads ---------------------

Wednesday, August 8, 2018: 23:45:49 CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/parafly/bin/ParaFly -c recursive_trinity.cmds -CPU 4 -v
Number of Commands: 3
succeeded(3) 100% completed.

All commands completed successfully. :-)

** Harvesting all assembled transcripts into a single multi-fasta file...

Wednesday, August 8, 2018: 23:45:57 CMD: find read_partitions/ -name '*inity.fasta' | /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/partitioned_trinity_aggregator.pl TRINITY_DN > Trinity.fasta.tmp

###################################################################
Butterfly assemblies are written to /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_H.Trinity.fasta
###################################################################

##BCR_K##
Left read files: $VAR1 = [
'/scratch/out_test2/cell1/aligned_reads/cell1_BCR_K_1.fastq'
];
Right read files: $VAR1 = [
'/scratch/out_test2/cell1/aligned_reads/cell1_BCR_K_2.fastq'
];
Trinity version: Trinity-v2.4.0
** NOTE: Latest version of Trinity is Trinity-v2.7.0-PRERELEASE, and can be obtained at:
https://github.com/trinityrnaseq/trinityrnaseq/releases

Wednesday, August 8, 2018: 23:45:58 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/ExitTester.jar 0
Wednesday, August 8, 2018: 23:45:58 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/ExitTester.jar 1
Wednesday, August 8, 2018: 23:45:58 CMD: mkdir -p /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K
Wednesday, August 8, 2018: 23:45:58 CMD: mkdir -p /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis

-------------- Trinity Phase 1: Clustering of RNA-Seq Reads ---------------------

Converting input files. (in parallel)Wednesday, August 8, 2018: 23:45:58 CMD: cat /scratch/out_test2/cell1/aligned_reads/cell1_BCR_K_1.fastq | seqtk-trinity seq -A - >> left.fa
Wednesday, August 8, 2018: 23:45:58 CMD: cat /scratch/out_test2/cell1/aligned_reads/cell1_BCR_K_2.fastq | seqtk-trinity seq -A - >> right.fa
Wednesday, August 8, 2018: 23:45:58 CMD: touch right.fa.ok
Wednesday, August 8, 2018: 23:45:58 CMD: touch left.fa.ok
Wednesday, August 8, 2018: 23:45:58 CMD: touch left.fa.ok right.fa.ok
Wednesday, August 8, 2018: 23:45:58 CMD: cat left.fa right.fa > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa
Wednesday, August 8, 2018: 23:45:58 CMD: touch /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa.ok

----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --

Running CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/jellyfish/bin/jellyfish count -t 4 -m 25 -s 100000000 --canonical /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa
Running CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/jellyfish/bin/jellyfish dump -L 1 mer_counts.jf > jellyfish.kmers.fa
Running CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/jellyfish/bin/jellyfish histo -t 4 -o jellyfish.kmers.fa.histo mer_counts.jf

--------------- Inchworm ---------------------
-- (Linear contig construction from k-mers) --

Running CMD: /trinityrnaseq-Trinity-v2.4.0/Inchworm/bin//inchworm --kmers jellyfish.kmers.fa --run_inchworm -K 25 -L 25 --monitor 1 --DS --num_threads 4 --PARALLEL_IWORM > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa.tmp
Running CMD: mv /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa.tmp /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa
Wednesday, August 8, 2018: 23:45:59 CMD: touch /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa.finished

-------------------- Chrysalis -------------------------
-- (Contig Clustering & de Bruijn Graph Construction) --

inchworm_target: /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa
bowite_reads_fa: /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa
chrysalis_reads_fa: /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa

Running CMD: /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/filter_iworm_by_min_length_or_cov.pl /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa 100 10 > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/inchworm.K25.L25.DS.fa.min100
Running CMD: bowtie2-build -o 3 /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/inchworm.K25.L25.DS.fa.min100 /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/inchworm.K25.L25.DS.fa.min100 1>/dev/null
Running CMD: bash -c " set -o pipefail;bowtie2 --local -k 2 --threads 4 -f --score-min G,46,0 -x /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/inchworm.K25.L25.DS.fa.min100 /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa | samtools view -@ 4 -F4 -Sb - | samtools sort -m 134217728 -@ 4 -no - - > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/iworm.bowtie.nameSorted.bam"
Running CMD: /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/scaffold_iworm_contigs.pl /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/iworm.bowtie.nameSorted.bam /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/iworm_scaffolds.txt
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/GraphFromFasta -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa -r /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa -min_contig_length 200 -min_glue 2 -glue_factor 0.05 -min_iso_ratio 0.05 -t 4 -k 24 -kk 48 > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/iworm_cluster_welds_graph.txt
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/BubbleUpClustering -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/inchworm.K25.L25.DS.fa -weld_graph /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/iworm_cluster_welds_graph.txt -min_contig_length 200 > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/GraphFromIwormFasta.out
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/CreateIwormFastaBundle -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/GraphFromIwormFasta.out -o /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/bundled_iworm_contigs.fasta -min 200
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/ReadsToTranscripts -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/both.fa -f /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/bundled_iworm_contigs.fasta -o /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/readsToComponents.out -t 4 -max_mem_reads 50000000
Running CMD: /usr/bin/sort --parallel=4 -T . -S 1G -k 1,1n /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/readsToComponents.out > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis/readsToComponents.out.sort
Wednesday, August 8, 2018: 23:46:01 CMD: mkdir -p read_partitions/Fb_0/CBin_0
Wednesday, August 8, 2018: 23:46:01 CMD: touch partitioned_reads.files.list.ok
Wednesday, August 8, 2018: 23:46:01 CMD: /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/write_partitioned_trinity_cmds.pl --reads_list_file partitioned_reads.files.list --CPU 1 --max_memory 1G --run_as_paired --seqType fa --trinity_complete --full_cleanup > recursive_trinity.cmds
Wednesday, August 8, 2018: 23:46:02 CMD: touch recursive_trinity.cmds.ok
Wednesday, August 8, 2018: 23:46:02 CMD: touch recursive_trinity.cmds.ok

------------ Trinity Phase 2: Assembling Clusters of Reads ---------------------

Wednesday, August 8, 2018: 23:46:02 CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/parafly/bin/ParaFly -c recursive_trinity.cmds -CPU 4 -v
Number of Commands: 1
succeeded(1) 100% completed.

All commands completed successfully. :-)

** Harvesting all assembled transcripts into a single multi-fasta file...

Wednesday, August 8, 2018: 23:46:06 CMD: find read_partitions/ -name '*inity.fasta' | /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/partitioned_trinity_aggregator.pl TRINITY_DN > Trinity.fasta.tmp

###################################################################
Butterfly assemblies are written to /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_K.Trinity.fasta
###################################################################

##BCR_L##
Left read files: $VAR1 = [
'/scratch/out_test2/cell1/aligned_reads/cell1_BCR_L_1.fastq'
];
Right read files: $VAR1 = [
'/scratch/out_test2/cell1/aligned_reads/cell1_BCR_L_2.fastq'
];
Trinity version: Trinity-v2.4.0
** NOTE: Latest version of Trinity is Trinity-v2.7.0-PRERELEASE, and can be obtained at:
https://github.com/trinityrnaseq/trinityrnaseq/releases

Wednesday, August 8, 2018: 23:46:07 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/ExitTester.jar 0
Wednesday, August 8, 2018: 23:46:07 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/ExitTester.jar 1
Wednesday, August 8, 2018: 23:46:07 CMD: mkdir -p /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L
Wednesday, August 8, 2018: 23:46:07 CMD: mkdir -p /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis

-------------- Trinity Phase 1: Clustering of RNA-Seq Reads ---------------------

Converting input files. (in parallel)Wednesday, August 8, 2018: 23:46:07 CMD: cat /scratch/out_test2/cell1/aligned_reads/cell1_BCR_L_1.fastq | seqtk-trinity seq -A - >> left.fa
Wednesday, August 8, 2018: 23:46:07 CMD: cat /scratch/out_test2/cell1/aligned_reads/cell1_BCR_L_2.fastq | seqtk-trinity seq -A - >> right.fa
Wednesday, August 8, 2018: 23:46:07 CMD: touch right.fa.ok
Wednesday, August 8, 2018: 23:46:07 CMD: touch left.fa.ok
Wednesday, August 8, 2018: 23:46:07 CMD: touch left.fa.ok right.fa.ok
Wednesday, August 8, 2018: 23:46:07 CMD: cat left.fa right.fa > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa
Wednesday, August 8, 2018: 23:46:07 CMD: touch /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa.ok

----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --

Running CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/jellyfish/bin/jellyfish count -t 4 -m 25 -s 100000000 --canonical /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa
Running CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/jellyfish/bin/jellyfish dump -L 1 mer_counts.jf > jellyfish.kmers.fa
Running CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/jellyfish/bin/jellyfish histo -t 4 -o jellyfish.kmers.fa.histo mer_counts.jf

--------------- Inchworm ---------------------
-- (Linear contig construction from k-mers) --

Running CMD: /trinityrnaseq-Trinity-v2.4.0/Inchworm/bin//inchworm --kmers jellyfish.kmers.fa --run_inchworm -K 25 -L 25 --monitor 1 --DS --num_threads 4 --PARALLEL_IWORM > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa.tmp
Running CMD: mv /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa.tmp /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa
Wednesday, August 8, 2018: 23:46:09 CMD: touch /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa.finished

-------------------- Chrysalis -------------------------
-- (Contig Clustering & de Bruijn Graph Construction) --

inchworm_target: /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa
bowite_reads_fa: /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa
chrysalis_reads_fa: /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa

Running CMD: /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/filter_iworm_by_min_length_or_cov.pl /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa 100 10 > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/inchworm.K25.L25.DS.fa.min100
Running CMD: bowtie2-build -o 3 /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/inchworm.K25.L25.DS.fa.min100 /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/inchworm.K25.L25.DS.fa.min100 1>/dev/null
Running CMD: bash -c " set -o pipefail;bowtie2 --local -k 2 --threads 4 -f --score-min G,46,0 -x /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/inchworm.K25.L25.DS.fa.min100 /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa | samtools view -@ 4 -F4 -Sb - | samtools sort -m 134217728 -@ 4 -no - - > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/iworm.bowtie.nameSorted.bam"
Running CMD: /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/scaffold_iworm_contigs.pl /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/iworm.bowtie.nameSorted.bam /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/iworm_scaffolds.txt
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/GraphFromFasta -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa -r /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa -min_contig_length 200 -min_glue 2 -glue_factor 0.05 -min_iso_ratio 0.05 -t 4 -k 24 -kk 48 > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/iworm_cluster_welds_graph.txt
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/BubbleUpClustering -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/inchworm.K25.L25.DS.fa -weld_graph /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/iworm_cluster_welds_graph.txt -min_contig_length 200 > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/GraphFromIwormFasta.out
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/CreateIwormFastaBundle -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/GraphFromIwormFasta.out -o /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/bundled_iworm_contigs.fasta -min 200
Running CMD: /trinityrnaseq-Trinity-v2.4.0/Chrysalis/ReadsToTranscripts -i /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/both.fa -f /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/bundled_iworm_contigs.fasta -o /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/readsToComponents.out -t 4 -max_mem_reads 50000000
Running CMD: /usr/bin/sort --parallel=4 -T . -S 1G -k 1,1n /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/readsToComponents.out > /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis/readsToComponents.out.sort
Wednesday, August 8, 2018: 23:46:12 CMD: mkdir -p read_partitions/Fb_0/CBin_0
Wednesday, August 8, 2018: 23:46:12 CMD: touch partitioned_reads.files.list.ok
Wednesday, August 8, 2018: 23:46:12 CMD: /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/write_partitioned_trinity_cmds.pl --reads_list_file partitioned_reads.files.list --CPU 1 --max_memory 1G --run_as_paired --seqType fa --trinity_complete --full_cleanup > recursive_trinity.cmds
Wednesday, August 8, 2018: 23:46:13 CMD: touch recursive_trinity.cmds.ok
Wednesday, August 8, 2018: 23:46:13 CMD: touch recursive_trinity.cmds.ok

------------ Trinity Phase 2: Assembling Clusters of Reads ---------------------

Wednesday, August 8, 2018: 23:46:13 CMD: /trinityrnaseq-Trinity-v2.4.0/trinity-plugins/parafly/bin/ParaFly -c recursive_trinity.cmds -CPU 4 -v
Number of Commands: 1
succeeded(1) 100% completed.

All commands completed successfully. :-)

** Harvesting all assembled transcripts into a single multi-fasta file...

Wednesday, August 8, 2018: 23:46:21 CMD: find read_partitions/ -name '*inity.fasta' | /trinityrnaseq-Trinity-v2.4.0/util/support_scripts/partitioned_trinity_aggregator.pl TRINITY_DN > Trinity.fasta.tmp

###################################################################
Butterfly assemblies are written to /scratch/out_test2/cell1/Trinity_output/Trinity_cell1_BCR_L.Trinity.fasta
###################################################################

##Running BLAST##
Performing Blast on ['BCR_H', 'BCR_K', 'BCR_L']
##BCR_H##
##BCR_K##
##BCR_L##

##Running IgBLAST##
Ig_seqtype: Ig
Performing IgBlast on ['BCR_H', 'BCR_K', 'BCR_L']
##BCR_H##
##BCR_K##
##BCR_L##

     START> MakeDB
   ALIGNER> IgBlast

ALIGNER_OUTPUT> cell1_BCR_H.fmt7
SEQ_FILE> cell1_BCR_H.Trinity.fasta
NO_PARSE> False
PARTIAL> False
SCORES> True
REGIONS> True

PROGRESS> 23:46:34 [Done ] 0.0 min

PROGRESS> 23:46:34 [####################] 100% (3) 0.0 min

OUTPUT> /scratch/out_test2/cell1/IgBLAST_output/cell1_BCR_H_db-pass.tab
PASS> 1
FAIL> 2
END> MakeDb

     START> MakeDB
   ALIGNER> IgBlast

ALIGNER_OUTPUT> cell1_BCR_K.fmt7
SEQ_FILE> cell1_BCR_K.Trinity.fasta
NO_PARSE> False
PARTIAL> False
SCORES> True
REGIONS> True

PROGRESS> 23:46:34 [Done ] 0.0 min

PROGRESS> 23:46:34 [####################] 100% (1) 0.0 min

OUTPUT> /scratch/out_test2/cell1/IgBLAST_output/cell1_BCR_K_db-pass.tab
PASS> 1
FAIL> 0
END> MakeDb

     START> MakeDB
   ALIGNER> IgBlast

ALIGNER_OUTPUT> cell1_BCR_L.fmt7
SEQ_FILE> cell1_BCR_L.Trinity.fasta
NO_PARSE> False
PARTIAL> False
SCORES> True
REGIONS> True

PROGRESS> 23:46:34 [Done ] 0.0 min

PROGRESS> 23:46:34 [####################] 100% (1) 0.0 min

OUTPUT> /scratch/out_test2/cell1/IgBLAST_output/cell1_BCR_L_db-pass.tab
PASS> 1
FAIL> 0
END> MakeDb

##Running Kallisto##
##Making Kallisto indices##

[build] loading fasta file /scratch/out_test2/cell1/expression_quantification/kallisto_index/cell1_transcriptome.fa
[build] k-mer length: 31
[build] warning: clipped off poly-A tail (longer than 10)
from 1549 target sequences
[build] warning: replaced 4 non-ACGUT characters in the input sequence
with pseudorandom nucleotides
[build] counting k-mers ... Traceback (most recent call last):
File "/usr/local/bin/bracer", line 11, in
load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/launcher.py", line 43, in launch
Task().run()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 369, in run
self.quantify(cell)
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 605, in quantify
self.trimmed_fastq2, self.keep_trimmed_reads)
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/bracer_func.py", line 2110, in quantify_with_kallisto
subprocess.check_call(index_command)
File "/usr/lib/python3.5/subprocess.py", line 271, in check_call
raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command '['/kallisto_linux-v0.43.1/kallisto', 'index', '-i', '/scratch/out_test2/cell1/expression_quantification/kallisto_index/cell1_transcriptome.idx', '/scratch/out_test2/cell1/expression_quantification/kallisto_index/cell1_transcriptome.fa']' returned non-zero exit status -9
Lindas-MacBook-Pro:test_data lindalan$ ls
cell1_1.fastq cell1_2.fastq expected_summary out_test out_test2 results
Lindas-MacBook-Pro:test_data lindalan$ cd out_test
Lindas-MacBook-Pro:out_test lindalan$ ls
cellAAA
Lindas-MacBook-Pro:out_test lindalan$ cd cellAAA/
Lindas-MacBook-Pro:cellAAA lindalan$ ls
BLAST_output Trinity_output expression_quantification trimmed_reads
IgBLAST_output aligned_reads filtered_BCR_seqs unfiltered_BCR_seqs
Lindas-MacBook-Pro:cellAAA lindalan$ cd /Users/lindalan/docker/bracer/bracer/test_data
Lindas-MacBook-Pro:test_data lindalan$ docker run -it --rm -v $PWD:/scratch -w /scratch teichlab/bracer summarise -p 4 -g pdf /scratch/out_test2
usage: bracer [-h] [--ncores ] [--config_file <CONFIG_FILE>]
[--resource_dir <RESOURCE_DIR>] [--species SPECIES]
[--loci LOCI [LOCI ...]] [--use_unfiltered]
[--graph_format <GRAPH_FORMAT>] [--no_networks] [--IGH_networks]
[--dist ] [--include_multiplets] [--infer_lineage]

bracer: error: unrecognized arguments: -g /scratch/out_test2
Lindas-MacBook-Pro:test_data lindalan$ docker run -it --rm -v $PWD:/scratch -w /scratch teichlab/bracer summarise -p 4 --g pdf /scratch/out_test2
Traceback (most recent call last):
File "/usr/local/bin/bracer", line 11, in
load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/launcher.py", line 43, in launch
Task().run()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 746, in run
self.loci, cells)
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 1036, in write_reconstruction_statistics
pc = round((count/float(total_cells))*100, 1)
ZeroDivisionError: float division by zero
Lindas-MacBook-Pro:test_data lindalan$ docker run -it --rm -v $PWD:/scratch -w /scratch teichlab/bracer summarise -p 4 /scratch/out_test2
Traceback (most recent call last):
File "/usr/local/bin/bracer", line 11, in
load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/launcher.py", line 43, in launch
Task().run()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 746, in run
self.loci, cells)
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 1036, in write_reconstruction_statistics
pc = round((count/float(total_cells))*100, 1)
ZeroDivisionError: float division by zero
Lindas-MacBook-Pro:test_data lindalan$ ls
cell1_1.fastq cell1_2.fastq expected_summary out_test out_test2 results
Lindas-MacBook-Pro:test_data lindalan$ cd out_test2
Lindas-MacBook-Pro:out_test2 lindalan$ ls
cell1 cell2 cellA filtered_BCR_summary results
Lindas-MacBook-Pro:out_test2 lindalan$ cd filtered_BCR_summary/
Lindas-MacBook-Pro:filtered_BCR_summary lindalan$ ls
BCR_summary.txt
Lindas-MacBook-Pro:filtered_BCR_summary lindalan$ cd ..
Lindas-MacBook-Pro:out_test2 lindalan$ cd results/
Lindas-MacBook-Pro:results lindalan$ ls
cell1
Lindas-MacBook-Pro:results lindalan$ cd cell1/
Lindas-MacBook-Pro:cell1 lindalan$ ls
BLAST_output Trinity_output expression_quantification unfiltered_BCR_seqs
IgBLAST_output aligned_reads filtered_BCR_seqs
Lindas-MacBook-Pro:cell1 lindalan$ cd ..
Lindas-MacBook-Pro:results lindalan$ ls
cell1
Lindas-MacBook-Pro:results lindalan$ cd out
-bash: cd: out: No such file or directory
Lindas-MacBook-Pro:results lindalan$ cd ..
Lindas-MacBook-Pro:out_test2 lindalan$ ls
cell1 cell2 cellA filtered_BCR_summary results
Lindas-MacBook-Pro:out_test2 lindalan$ cd ..
Lindas-MacBook-Pro:test_data lindalan$ ls
cell1_1.fastq cell1_2.fastq expected_summary out_test out_test2 results
Lindas-MacBook-Pro:test_data lindalan$ cd out_test
Lindas-MacBook-Pro:out_test lindalan$ ls
cellAAA
Lindas-MacBook-Pro:out_test lindalan$ cd ..ls
-bash: cd: ..ls: No such file or directory
Lindas-MacBook-Pro:out_test lindalan$ cd ..
Lindas-MacBook-Pro:test_data lindalan$ ls
cell1_1.fastq cell1_2.fastq expected_summary out_test out_test2 results
Lindas-MacBook-Pro:test_data lindalan$ cd expected_summary/
Lindas-MacBook-Pro:expected_summary lindalan$ ls
BCR_summary.txt clonotype_network_without_identifiers.pdf igblast_input_H.fa
IMGT_gapped_db.tab clonotype_sizes.pdf igblast_input_L.fa
changeo_input_H.tab clonotype_sizes.txt isotype_distribution.pdf
changeo_input_H_clone-pass.tab concatenated_lineage_input.tab lineage_trees
changeo_input_K.tab full_length_seqs.pdf reconstructed_lengths_BCR_H.pdf
changeo_input_L.tab igblast_H.fmt7 reconstructed_lengths_BCR_H.txt
changeo_input_L_clone-pass.tab igblast_H_db-modified.tab reconstructed_lengths_BCR_K.txt
changeodb.tab igblast_H_db-modified_germ-pass.tab reconstructed_lengths_BCR_L.pdf
clonotype_network_with_identifiers.dot igblast_L.fmt7 reconstructed_lengths_BCR_L.txt
clonotype_network_with_identifiers.pdf igblast_L_db-modified.tab
clonotype_network_without_identifiers.dot igblast_L_db-modified_germ-pass.tab
Lindas-MacBook-Pro:expected_summary lindalan$ ls
BCR_summary.txt clonotype_network_without_identifiers.pdf igblast_input_H.fa
IMGT_gapped_db.tab clonotype_sizes.pdf igblast_input_L.fa
changeo_input_H.tab clonotype_sizes.txt isotype_distribution.pdf
changeo_input_H_clone-pass.tab concatenated_lineage_input.tab lineage_trees
changeo_input_K.tab full_length_seqs.pdf reconstructed_lengths_BCR_H.pdf
changeo_input_L.tab igblast_H.fmt7 reconstructed_lengths_BCR_H.txt
changeo_input_L_clone-pass.tab igblast_H_db-modified.tab reconstructed_lengths_BCR_K.txt
changeodb.tab igblast_H_db-modified_germ-pass.tab reconstructed_lengths_BCR_L.pdf
clonotype_network_with_identifiers.dot igblast_L.fmt7 reconstructed_lengths_BCR_L.txt
clonotype_network_with_identifiers.pdf igblast_L_db-modified.tab
clonotype_network_without_identifiers.dot igblast_L_db-modified_germ-pass.tab
Lindas-MacBook-Pro:expected_summary lindalan$ cd ..
Lindas-MacBook-Pro:test_data lindalan$ ls
cell1_1.fastq cell1_2.fastq expected_summary out_test out_test2 results
Lindas-MacBook-Pro:test_data lindalan$ cd out_test2
Lindas-MacBook-Pro:out_test2 lindalan$ docker run -it --rm -v $PWD:/scratch -w /scratch teichlab/bracer summarise -p 4 -g pdf /scratch/out_test2
usage: bracer [-h] [--ncores ] [--config_file <CONFIG_FILE>]
[--resource_dir <RESOURCE_DIR>] [--species SPECIES]
[--loci LOCI [LOCI ...]] [--use_unfiltered]
[--graph_format <GRAPH_FORMAT>] [--no_networks] [--IGH_networks]
[--dist ] [--include_multiplets] [--infer_lineage]

bracer: error: unrecognized arguments: -g /scratch/out_test2
Lindas-MacBook-Pro:out_test2 lindalan$ docker run -it --rm -v $PWD:/scratch -w /scratch teichlab/bracer summarise -p 4 --graph_format pdf /scratch/out_test2
Traceback (most recent call last):
File "/usr/local/bin/bracer", line 11, in
load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/launcher.py", line 43, in launch
Task().run()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 712, in run
subdirectories = next(os.walk(self.root_dir))[1]
StopIteration
Lindas-MacBook-Pro:out_test2 lindalan$ cd ..
Lindas-MacBook-Pro:test_data lindalan$ ls
cell1_1.fastq cell1_2.fastq expected_summary out_test out_test2 results
Lindas-MacBook-Pro:test_data lindalan$ cd out_test2
Lindas-MacBook-Pro:out_test2 lindalan$ ls
cell1 cell2 cellA filtered_BCR_summary results
Lindas-MacBook-Pro:out_test2 lindalan$ cd cellA
Lindas-MacBook-Pro:cellA lindalan$ docker run -it --rm -v $PWD:/scratch -w /scratch teichlab/bracer summarise -p 4 --graph_format
pdf /scratch/cellA
usage: bracer [-h] [--ncores ] [--config_file <CONFIG_FILE>]
[--resource_dir <RESOURCE_DIR>] [--species SPECIES]
[--loci LOCI [LOCI ...]] [--use_unfiltered]
[--graph_format <GRAPH_FORMAT>] [--no_networks] [--IGH_networks]
[--dist ] [--include_multiplets] [--infer_lineage]

bracer: error: argument --graph_format/-f: expected one argument
Lindas-MacBook-Pro:cellA lindalan$ docker run -it --rm -v $PWD:/scratch -w /scratch teichlab/bracer summarise -p 4 -f pdf /scratch/cellA
Traceback (most recent call last):
File "/usr/local/bin/bracer", line 11, in
load_entry_point('bracer==0.1', 'console_scripts', 'bracer')()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/launcher.py", line 43, in launch
Task().run()
File "/usr/local/lib/python3.5/dist-packages/bracer-0.1-py3.5.egg/bracerlib/tasks.py", line 712, in run
subdirectories = next(os.walk(self.root_dir))[1]
StopIteration

Cannot run the docker image

hi everyone,
First , I wish you a Happy New year !!!
I would like to test Bracer with the Docker Image, but I'm stuck at the start of the tutorial.

pip3 install -r /bracer/requirements.txt

$ /bracer/bracer/test
-sh: 174: /bracer/bracer/test: not found
$ /bracer/bracer test
Traceback (most recent call last):
  File "/bracer/bracer", line 17, in <module>
    from bracerlib.launcher import launch
  File "/bracer/bracerlib/launcher.py", line 2, in <module>
    import matplotlib as mpl
ImportError: No module named matplotlib

I add the path of matplolib,and the bracer path in my PATH, but nothing change
/usr/local/bin:/usr/bin:/bin:/usr/local/games:/usr/games:/home/nhipp/.local/lib/python3.5/site-packages/:/home/nhipp/.local/lib/python3.5/site-packages/matplotlib:/bracer

Maybe my brain is still in holliday but I cannot solve the problem.
Does-anybody have an idea !

EDIT: I used a ssh interactive Docker job submission, that why the command is not complete (in regard of the tutorial)
nicolas

Conda environment

It would be useful to create a conda environment for BraCeR so it can be installed through bioconda.
First requested in #9 .

BLAST step gives error and stops

Hi,
I managed to install all the dependence and run few test with Bracer.
I always mange to obtained the assembled BCR sequences with Trinity.
Then when the BLAST step starts, it always stops giving this error:
Command line argument error: Argument "query". File is not accessible: `[...]/Trinity_output/A1_TEST_BCR_H.Trinity.fasta'

So somehow is not able to open the assembled fasta file?
Any suggestion on how I might resolve this?

Thank you very much for the attention
BW
Sabrina

Docker container is outdated and does not build

I noticed that bracer container at dockerhub is 1 years old. I tried to build it from bracer Dockerfile but it does not build. I also noticed that it uses very outdated software versions

IgBLAST crashes in docker container

When I ran the latest docker container on test fastq data it crashes with IgBLAST subprocess
stdout.txt
stderr.txt

Here is the command that was run:

bracer assemble --ncores 28 --species Hsap  cell_1 bracer_results /cromwell-executions/BCR_extraction/39483cc3-3a87-4370-96bb-7c7e8e4112dd/call-bracer_assemble/inputs/1726693592/cell1_1.fastq /cromwell-executions/BCR_extraction/39483cc3-3a87-4370-96bb-7c7e8e4112dd/call-bracer_assemble/inputs/1726693592/cell1_2.fastq

Keep track of ambiguity?

Here is partial output of a cell from filtered_BCR_seqs/fitlered_BCRs.txt:

------------------
test
------------------
BCR_H recombinants: 0/1
BCR_K recombinants: 0/2
BCR_L recombinants: 0/0


#BCR_H#
##TRINITY_DN0_c0_g1_i2##
V segment:      IGHV1-3*01,IGHV3-11*04,IGHV3-11*06,IGHV3-21*01,IGHV3-30*01,IGHV3-30*03,IGHV3-30*04,IGHV3-30*05,IGHV3-30*06,IGHV3-30*07,IGHV3-30*09,IGHV3-30*10,IGHV3-30*11,IGHV3-30*13,IGHV3-30*14,IGHV3-30*15,IGHV3-30*16,IGHV3-30*17,IGHV3-30*19,IGHV3-30-3*01
D segment:      IGHD6-13*01
J segment:      IGHJ4*02
C segment:      IGHG1*03
ID:     IGHV1-3_TGTGCGAGAGATCTCTGGGTGGACTCGCAGCAGCCACCGGGGCACTTCTGG_IGHJ4
TPM:    1020.28
Productive:     False
Stop codon:     False
In frame:       False
Full length:    False
Sequence length:        465
All possible V genes:   IGHV1-3, IGHV3-11, IGHV3-21, IGHV3-30, IGHV3-30-3
All possible J genes:   IGHJ4, IGHJ5

Segment query_id        subject_id      % identity      alignment length        mismatches      gap opens       gaps    q start q end   s start s end   e value bit score
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV1-3*01      96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV3-11*04     96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV3-11*06     96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV3-21*01     96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV3-30*01     96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV3-30*03     96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2

Does bracer keep track of this ambiguity in V gene assignment when doing lineage analysis? That is, if another cell in the sample from the same lineage captures enough of the V gene to resolve it as, say VH3-21, will that get picked up despite the use of VH1-3 in the ID for this cell?

Unrecognized error on MakeDB (MakeDb.py: error: unrecognized arguments: --regions --scores)

Hi,

I am trying to run bracer but I am getting this MakeDB error that I can't figure out the reason.
My MakeDb seems to be updated.
Can you please help me with this?

Thanks
MakeDb.py: 0.4.6 2019.07.19

Warning: [blastn] Examining 5 or more matches is recommended                                                                                  [25/5480]
##BCR_K##
Warning: [blastn] Examining 5 or more matches is recommended
##BCR_L##
Warning: [blastn] Examining 5 or more matches is recommended

##Running IgBLAST##
Ig_seqtype: Ig
Performing IgBlast on ['BCR_H', 'BCR_K', 'BCR_L']
##BCR_H##
##BCR_K##
##BCR_L##

usage: MakeDb.py [--version] [-h]  ...
MakeDb.py: error: unrecognized arguments: --regions --scores
Traceback (most recent call last):
  File "/ru-auth/local/home/trezende/bin/bracer", line 21, in <module>
    launch()
  File "/data_alpha/home/trezende/localPrograms/bracer/bracerlib/launcher.py", line 43, in launch
    Task().run()
  File "/data_alpha/home/trezende/localPrograms/bracer/bracerlib/tasks.py", line 374, in run
    cell = self.ig_blast() # Run IgBlast
  File "/data_alpha/home/trezende/localPrograms/bracer/bracerlib/tasks.py", line 547, in ig_blast
    self.create_changeo_db()
  File "/data_alpha/home/trezende/localPrograms/bracer/bracerlib/tasks.py", line 581, in create_changeo_db
    ungapped_seq_location, self.cell_name)
  File "/data_alpha/home/trezende/localPrograms/bracer/bracerlib/bracer_func.py", line 2230, in run_MakeDb_for_cell
    subprocess.check_call(command)
  File "/ru-auth/local/home/trezende/anaconda3/envs/bioconda3/lib/python3.7/subprocess.py", line 347, in check_call
    raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command '['MakeDb.py', 'igblast', '-i', '/gamma_data1/trezende/Juhee/Plate5_A12/Plate5_A12/IgBLAST_output/Plate5_A12_BCR_H.fmt7', '-s', '/gamma_data1/trezende/Juhee/Plate5_A12/Plate5_A12/Trinity_output/Plate5_A12_BCR_H.Trinity.fasta', '-r', '/data_alpha/home/trezende/localPrograms/bracer/resources/Mmus/imgt_gapped_resources/raw_seqs/BCR_H_V.fa', '/data_alpha/home/trezende/localPrograms/bracer/resources/Mmus/raw_seqs/BCR_H_D.fa', '/data_alpha/home/trezende/localPrograms/bracer/resources/Mmus/raw_seqs/BCR_H_J.fa', '--regions', '--scores']' returned non-zero exit status 2.

Not all cells included in Bracer summarize output

Hi,
I noticed that not all cells are included in the changeodb file that I obtain after running bracer summarize (even if I include the "--include_multiplets"option).
When I check for reconstructed BCRs sequences into the "filtered_BCR_seqs" folder, and I can find the text file with annotated BCRs, perfectly functional and with TPM annotation.
Also, the "BCR_summary.txt" file states that 178 cells were included, while I have actually 275 folders as output of bracer assemble.
Why are those almost 100 cells not included in the bracer summarize output?

Thank you for your attention!
Kind regards
Sabrina

test results differ from expected

Hi!
I have run bracer test and have different results, but there is no error when testing. Is it common?
my results:

BCR_H reconstruction:   2 / 3 (66.7%)
BCR_K reconstruction:   0 / 3 (0.0%)
BCR_L reconstruction:   3 / 3 (100.0%)

Paired HK productive reconstruction:    0 / 3 (0.0%)
Paired HL productive reconstruction:    2 / 3 (66.7%)
Paired KL productive reconstruction:    0 / 3 (0.0%)

+--------+----------------+---------------+----------------+
|        | 0 recombinants | 1 recombinant | 2 recombinants |
+--------+----------------+---------------+----------------+
| all H  | 1              | 2 (100%)      | 0 (0%)         |
| all K  | 2              | 1 (100%)      | 0 (0%)         |
| all L  | 0              | 3 (100%)      | 0 (0%)         |
| prod H | 1              | 2 (100%)      | 0 (0%)         |
| prod K | 3              | 0 (N/A%)      | 0 (N/A%)       |
| prod L | 0              | 3 (100%)      | 0 (0%)         |
+--------+----------------+---------------+----------------+


##Cells with more than two recombinants for a locus##

The following cells are likely multiplets or contaminated as they contain more than two recombinants for a locus. Consider removing them from downstream analysis.
None

##Proportion of full-length sequences of all recovered sequences##

        H       K       L
all     2/2 (100%)      1/1 (100%)      3/3 (100%)
prod    2/2 (100%)      0/0 (N/A%)      3/3 (100%)

##Isotype of cells with productive heavy chain##

Isotype cells   % of cells
IGHA1   2       100.00


#Clonotype groups#
This is a text representation of the groups shown in clonotype_network_with_identifiers.pdf.
It does not exclude cells that only share heavy chain and not light chain if Summarise is run with --IGH_networks.

cell2, cell3


#Cells with no reconstructed sequences#
None

expected results:

BCR_H reconstruction:   3 / 3 (100.0%)
BCR_K reconstruction:   0 / 3 (0.0%)
BCR_L reconstruction:   3 / 3 (100.0%)

Paired HK productive reconstruction:    0 / 3 (0.0%)
Paired HL productive reconstruction:    3 / 3 (100.0%)
Paired KL productive reconstruction:    0 / 3 (0.0%)

+--------+----------------+---------------+----------------+
|        | 0 recombinants | 1 recombinant | 2 recombinants |
+--------+----------------+---------------+----------------+
| all H  | 0              | 3 (100%)      | 0 (0%)         |
| all K  | 2              | 1 (100%)      | 0 (0%)         |
| all L  | 0              | 3 (100%)      | 0 (0%)         |
| prod H | 0              | 3 (100%)      | 0 (0%)         |
| prod K | 3              | 0 (N/A%)      | 0 (N/A%)       |
| prod L | 0              | 3 (100%)      | 0 (0%)         |
+--------+----------------+---------------+----------------+


##Cells with more than two recombinants for a locus##

The following cells are likely multiplets or contaminated as they contain more than two recombinants for a locus. Consider removing them from downstream analysis.
None

##Proportion of full-length sequences of all recovered sequences##

        H       K       L
all     3/3 (100%)      1/1 (100%)      2/3 (67%)
prod    3/3 (100%)      0/0 (N/A%)      2/3 (67%)

##Isotype of cells with productive heavy chain##

Isotype cells   % of cells
IGHA1   2       66.67
IGHG1   1       33.33


#Clonotype groups#
This is a text representation of the groups shown in clonotype_network_with_identifiers.pdf.
It does not exclude cells that only share heavy chain and not light chain if Summarise is run with --IGH_networks.

cell2, cell3


#Cells with no reconstructed sequences#
None

test log:

56438 reads; of these:
  56438 (100.00%) were paired; of these:
    35350 (62.64%) aligned concordantly 0 times
    21088 (37.36%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    35350 pairs aligned concordantly 0 times; of these:
      73 (0.21%) aligned discordantly 1 time
    ----
    35277 pairs aligned 0 times concordantly or discordantly; of these:
      70554 mates make up the pairs; of these:
        69268 (98.18%) aligned 0 times
        232 (0.33%) aligned exactly 1 time
        1054 (1.49%) aligned >1 times
38.63% overall alignment rate
56438 reads; of these:
  56438 (100.00%) were paired; of these:
    56438 (100.00%) aligned concordantly 0 times
    0 (0.00%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    56438 pairs aligned concordantly 0 times; of these:
      0 (0.00%) aligned discordantly 1 time
    ----
    56438 pairs aligned 0 times concordantly or discordantly; of these:
      112876 mates make up the pairs; of these:
        112876 (100.00%) aligned 0 times
        0 (0.00%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
0.00% overall alignment rate
56438 reads; of these:
  56438 (100.00%) were paired; of these:
    48319 (85.61%) aligned concordantly 0 times
    8119 (14.39%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    48319 pairs aligned concordantly 0 times; of these:
      114 (0.24%) aligned discordantly 1 time
    ----
    48205 pairs aligned 0 times concordantly or discordantly; of these:
      96410 mates make up the pairs; of these:
        95663 (99.23%) aligned 0 times
        195 (0.20%) aligned exactly 1 time
        552 (0.57%) aligned >1 times
15.25% overall alignment rate
56438 reads; of these:
  56438 (100.00%) were paired; of these:
    31766 (56.28%) aligned concordantly 0 times
    24672 (43.72%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    31766 pairs aligned concordantly 0 times; of these:
      270 (0.85%) aligned discordantly 1 time
    ----
    31496 pairs aligned 0 times concordantly or discordantly; of these:
      62992 mates make up the pairs; of these:
        61549 (97.71%) aligned 0 times
        144 (0.23%) aligned exactly 1 time
        1299 (2.06%) aligned >1 times
45.47% overall alignment rate

[build] loading fasta file /Personal/zhouxin/software/bracer/test_data/results/cell1/expression_quantification/kallisto_index/cell1_transcriptome.fa
[build] k-mer length: 31
[build] warning: clipped off poly-A tail (longer than 10)
        from 1827 target sequences
[build] warning: replaced 4 non-ACGUT characters in the input sequence
        with pseudorandom nucleotides
[build] counting k-mers ... done.
[build] building target de Bruijn graph ...  done 
[build] creating equivalence classes ...  done
[build] target de Bruijn graph has 1510231 contigs and contains 142452662 k-mers 


[quant] fragment length distribution will be estimated from the data
[index] k-mer length: 31
[index] number of targets: 231,959
[index] number of k-mers: 142,452,662
[index] number of equivalence classes: 990,749
[quant] running in paired-end mode
[quant] will process pair 1: /Personal/zhouxin/software/bracer/test_data/cell1_1.fastq
                             /Personal/zhouxin/software/bracer/test_data/cell1_2.fastq
[quant] finding pseudoalignments for the reads ... done
[quant] processed 56,438 reads, 41,888 reads pseudoaligned
[quant] estimated average fragment length: 135.93
[   em] quantifying the abundances ... done
[   em] the Expectation-Maximization algorithm ran for 246 rounds

/SGRNJ/Public/Software/conda_env/Bracer/lib/python3.7/site-packages/seaborn/distributions.py:2557: FutureWarning: `distplot` is a deprecated function and will be removed in a future version. Please adapt your code to use either `displot` (a figure-level function with similar flexibility) or `histplot` (an axes-level function for histograms).
  warnings.warn(msg, FutureWarning)
/SGRNJ/Public/Software/conda_env/Bracer/lib/python3.7/site-packages/seaborn/distributions.py:306: UserWarning: Dataset has 0 variance; skipping density estimate.
  warnings.warn(msg, UserWarning)
/SGRNJ/Public/Software/conda_env/Bracer/lib/python3.7/site-packages/seaborn/distributions.py:2557: FutureWarning: `distplot` is a deprecated function and will be removed in a future version. Please adapt your code to use either `displot` (a figure-level function with similar flexibility) or `histplot` (an axes-level function for histograms).
  warnings.warn(msg, FutureWarning)

thank you!

The identity of the assembled contig is too low（igblast）

I’m using bracer to process my single cell data but I found that the assembled contigs are not so similar to the IMGT reference according to the result of Igblast.

For example, when I used Tracer to porcess the data, the similarity (identity(%) by Igblast) between the assembled contigs and the IMGT V/J reference are almost more than 99%, like the example below.

When I used Bracer, the similarity seemed to be very low, often less than 95%，even less than 90% in some samples, like the examples below.

As a result , most of （more than 90%） T cells or Macrophages in my data also had a positive result（bearing BCR） according to the bracer output.

So I‘m wondering if the “synthetic BCR genomes” was designed well enough to extract BCR-derived reads. It seems that many false positive reads were included, effecting the down stream analysis results.

Change-o/DefineClones.py ceases to have subcommands after 2018-01-10

Currently line 2163-2166 of bracer_func.py reads:

command = [DefineClones, "bygroup", '-d', changeo_input, '--mode', 'gene', '--act', 'set',  
                        '--model', model, '--dist', dist, '--sf', "JUNCTION", '--norm', 'len'] 
 
subprocess.check_call(command)

which calls DefineClones.py bygroup [...]. However, after 2018-01-10, DefineClones.py will no longer have subcommands since "bygroup" will be the only method used. Thus, subprocess.check_call will throw an error if the user's changeo is cloned after this date.

There should be version check on DefineClones.py, and change to command list accordingly if the version is larger or equal to 0.3.9.9999.

Docker image Trinity "No recombinats found"

Hi,
I am running Bracer on the docker image.
I already tried two files and they both stop at the Trinity step with the following comment:
Trinity run failed. Must investigate error above.
Trinity failed for locus
No successful Trinity assemblies
##No recombinants found##

Any idea on how can I solve this?
Thanks! :)
Sabrina

Bracer test failing at Trinity step with empty read files

$ bracer test -p 16 -c ./bracer.conf -o ./test
##Finding recombinant-derived reads##
Attempting new assembly for ['BCR_H', 'BCR_K', 'BCR_L']

Detected average R1 read length:
50.0
Short read length detected. BraCeR will run two rounds of alignment for heavy chain

##BCR_H##
56438 reads; of these:
56438 (100.00%) were paired; of these:
35350 (62.64%) aligned concordantly 0 times
21088 (37.36%) aligned concordantly exactly 1 time
0 (0.00%) aligned concordantly >1 times
----
35350 pairs aligned concordantly 0 times; of these:
73 (0.21%) aligned discordantly 1 time
----
35277 pairs aligned 0 times concordantly or discordantly; of these:
70554 mates make up the pairs; of these:
69268 (98.18%) aligned 0 times
232 (0.33%) aligned exactly 1 time
1054 (1.49%) aligned >1 times
38.63% overall alignment rate
56438 reads; of these:
56438 (100.00%) were paired; of these:
56438 (100.00%) aligned concordantly 0 times
0 (0.00%) aligned concordantly exactly 1 time
0 (0.00%) aligned concordantly >1 times
----
56438 pairs aligned concordantly 0 times; of these:
0 (0.00%) aligned discordantly 1 time
----
56438 pairs aligned 0 times concordantly or discordantly; of these:
112876 mates make up the pairs; of these:
112876 (100.00%) aligned 0 times
0 (0.00%) aligned exactly 1 time
0 (0.00%) aligned >1 times
0.00% overall alignment rate
##BCR_K##
56438 reads; of these:
56438 (100.00%) were paired; of these:
48319 (85.61%) aligned concordantly 0 times
8119 (14.39%) aligned concordantly exactly 1 time
0 (0.00%) aligned concordantly >1 times
----
48319 pairs aligned concordantly 0 times; of these:
114 (0.24%) aligned discordantly 1 time
----
48205 pairs aligned 0 times concordantly or discordantly; of these:
96410 mates make up the pairs; of these:
95663 (99.23%) aligned 0 times
195 (0.20%) aligned exactly 1 time
552 (0.57%) aligned >1 times
15.25% overall alignment rate
##BCR_L##
56438 reads; of these:
56438 (100.00%) were paired; of these:
31766 (56.28%) aligned concordantly 0 times
24672 (43.72%) aligned concordantly exactly 1 time
0 (0.00%) aligned concordantly >1 times
----
31766 pairs aligned concordantly 0 times; of these:
270 (0.85%) aligned discordantly 1 time
----
31496 pairs aligned 0 times concordantly or discordantly; of these:
62992 mates make up the pairs; of these:
61549 (97.71%) aligned 0 times
144 (0.23%) aligned exactly 1 time
1299 (2.06%) aligned >1 times
45.47% overall alignment rate

##Assembling Trinity Contigs##
##BCR_H##

 ______  ____   ____  ____   ____  ______  __ __
|      ||    \ |    ||    \ |    ||      ||  |  |
|      ||  D  ) |  | |  _  | |  | |      ||  |  |
|_|  |_||    /  |  | |  |  | |  | |_|  |_||  ~  |
  |  |  |    \  |  | |  |  | |  |   |  |  |___, |
  |  |  |  .  \ |  | |  |  | |  |   |  |  |     |
  |__|  |__|\_||____||__|__||____|  |__|  |____/

Left read files: $VAR1 = [
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_H_1.fastq'
];
Right read files: $VAR1 = [
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_H_2.fastq'
];
Trinity version: BLEEDING_EDGE
** NOTE: Latest version of Trinity is Trinity-v2.6.5, and can be obtained at:
https://github.com/trinityrnaseq/trinityrnaseq/releases

Tuesday, February 13, 2018: 23:22:25 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /booleanfs/apps/trinityrnaseq-devel/util/support_scripts/ExitTester.jar 0
Tuesday, February 13, 2018: 23:22:25 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /booleanfs/apps/trinityrnaseq-devel/util/support_scripts/ExitTester.jar 1
Tuesday, February 13, 2018: 23:22:25 CMD: mkdir -p /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_H
Tuesday, February 13, 2018: 23:22:25 CMD: mkdir -p /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/chrysalis

----------------------------------------------------------------------------------
-------------- Trinity Phase 1: Clustering of RNA-Seq Reads ---------------------
----------------------------------------------------------------------------------

---------------------------------------------------------------
------------ In silico Read Normalization ---------------------
-- (Removing Excess Reads Beyond 50 Coverage --
---------------------------------------------------------------

# running normalization on reads: $VAR1 = [
[
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_H_1.fastq'
],
[
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_H_2.fastq'
]
];

Tuesday, February 13, 2018: 23:22:25 CMD: /booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normalization.pl --seqType fq --JM 12G --max_cov 50 --min_cov 1 --CPU 16 --output /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/insilico_read_normalization --max_pct_stdev 10000 --left /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_H_1.fastq --right /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_H_2.fastq --pairs_together --PARALLEL_STATS
Converting input files. (both directions in parallel)CMD: seqtk-trinity seq -A /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_H_1.fastq >> left.fa
CMD: seqtk-trinity seq -A /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_H_2.fastq >> right.fa
CMD finished (0 seconds)
CMD finished (0 seconds)
Done converting input files.CMD: cat left.fa right.fa > both.fa
CMD finished (0 seconds)
-------------------------------------------
----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --
-------------------------------------------

CMD: jellyfish count -t 16 -m 25 -s 100000000 --canonical both.fa
CMD finished (2 seconds)
CMD: jellyfish histo -t 16 -o jellyfish.K25.min2.kmers.fa.histo mer_counts.jf
CMD finished (0 seconds)
CMD: jellyfish dump -L 2 mer_counts.jf > jellyfish.K25.min2.kmers.fa
CMD finished (0 seconds)
CMD: touch jellyfish.K25.min2.kmers.fa.success
CMD finished (0 seconds)
CMD: /booleanfs/apps/trinityrnaseq-devel/util/..//Inchworm/bin/fastaToKmerCoverageStats --reads left.fa --kmers jellyfish.K25.min2.kmers.fa --kmer_size 25 --num_threads 8 --DS > left.fa.K25.stats
CMD: /booleanfs/apps/trinityrnaseq-devel/util/..//Inchworm/bin/fastaToKmerCoverageStats --reads right.fa --kmers jellyfish.K25.min2.kmers.fa --kmer_size 25 --num_threads 8 --DS > right.fa.K25.stats
-reading Kmer occurrences...-reading Kmer occurrences...

done parsing 0 Kmers, 0 added, taking 0 seconds.
STATS_GENERATION_TIME: 0 seconds.

done parsing 0 Kmers, 0 added, taking 0 seconds.
STATS_GENERATION_TIME: 0 seconds.
CMD finished (0 seconds)
CMD finished (0 seconds)
-sorting each stats file by read name.
CMD: /booleanfs/sysapps/coreutilsv8.29/bin/sort --parallel=16 -k5,5 -T . -S 6G left.fa.K25.stats > left.fa.K25.stats.sort
CMD: /booleanfs/sysapps/coreutilsv8.29/bin/sort --parallel=16 -k5,5 -T . -S 6G right.fa.K25.stats > right.fa.K25.stats.sort
CMD finished (0 seconds)
CMD finished (0 seconds)
CMD: /booleanfs/apps/trinityrnaseq-devel/util/..//util/support_scripts//nbkc_merge_left_right_stats.pl --left left.fa.K25.stats.sort --right right.fa.K25.stats.sort --sorted > pairs.K25.stats
-opening left.fa.K25.stats.sort
-opening right.fa.K25.stats.sort
-done opening files.
CMD finished (0 seconds)
Error, pairs.K25.stats is empty. Be sure to check your fastq reads and ensure that the read names are identical except for the /1 or /2 designation. at /booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normalization.pl line 921.
Error, cmd: /booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normalization.pl --seqType fq --JM 12G --max_cov 50 --min_cov 1 --CPU 16 --output /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_H/insilico_read_normalization --max_pct_stdev 10000 --left /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_H_1.fastq --right /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_H_2.fastq --pairs_together --PARALLEL_STATS died with ret 512 at /booleanfs/apps/trinityrnaseq-devel/Trinity line 2578.
main::process_cmd("/booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normal"...) called at /booleanfs/apps/trinityrnaseq-devel/Trinity line 3124
main::normalize("/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinit"..., 50, ARRAY(0xb41d60), ARRAY(0xb41d48)) called at /booleanfs/apps/trinityrnaseq-devel/Trinity line 3071
main::run_normalization(50, ARRAY(0xb41d60), ARRAY(0xb41d48)) called at /booleanfs/apps/trinityrnaseq-devel/Trinity line 1291
Trinity failed for locus
##BCR_K##

 ______  ____   ____  ____   ____  ______  __ __
|      ||    \ |    ||    \ |    ||      ||  |  |
|      ||  D  ) |  | |  _  | |  | |      ||  |  |
|_|  |_||    /  |  | |  |  | |  | |_|  |_||  ~  |
  |  |  |    \  |  | |  |  | |  |   |  |  |___, |
  |  |  |  .  \ |  | |  |  | |  |   |  |  |     |
  |__|  |__|\_||____||__|__||____|  |__|  |____/

Left read files: $VAR1 = [
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_K_1.fastq'
];
Right read files: $VAR1 = [
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_K_2.fastq'
];
Trinity version: BLEEDING_EDGE
** NOTE: Latest version of Trinity is Trinity-v2.6.5, and can be obtained at:
https://github.com/trinityrnaseq/trinityrnaseq/releases

Tuesday, February 13, 2018: 23:22:28 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /booleanfs/apps/trinityrnaseq-devel/util/support_scripts/ExitTester.jar 0
Tuesday, February 13, 2018: 23:22:28 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /booleanfs/apps/trinityrnaseq-devel/util/support_scripts/ExitTester.jar 1
Tuesday, February 13, 2018: 23:22:28 CMD: mkdir -p /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_K
Tuesday, February 13, 2018: 23:22:28 CMD: mkdir -p /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/chrysalis

# running normalization on reads: $VAR1 = [
[
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_K_1.fastq'
],
[
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_K_2.fastq'
]
];

Tuesday, February 13, 2018: 23:22:28 CMD: /booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normalization.pl --seqType fq --JM 12G --max_cov 50 --min_cov 1 --CPU 16 --output /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/insilico_read_normalization --max_pct_stdev 10000 --left /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_K_1.fastq --right /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_K_2.fastq --pairs_together --PARALLEL_STATS
Converting input files. (both directions in parallel)CMD: seqtk-trinity seq -A /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_K_1.fastq >> left.fa
CMD: seqtk-trinity seq -A /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_K_2.fastq >> right.fa
CMD finished (0 seconds)
CMD finished (0 seconds)
CMD: touch left.fa.ok
CMD finished (0 seconds)
Done converting input files.CMD: cat left.fa right.fa > both.fa
CMD finished (0 seconds)
CMD: touch both.fa.ok
CMD finished (0 seconds)
-------------------------------------------
----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --
-------------------------------------------

done parsing 4712 Kmers, 4712 added, taking 0 seconds.

done parsing 4712 Kmers, 4712 added, taking 0 seconds.
STATS_GENERATION_TIME: 0 seconds.
CMD finished (0 seconds)
STATS_GENERATION_TIME: 0 seconds.
CMD finished (0 seconds)
CMD: touch left.fa.K25.stats.ok
CMD finished (0 seconds)
-sorting each stats file by read name.
CMD: /booleanfs/sysapps/coreutilsv8.29/bin/sort --parallel=16 -k5,5 -T . -S 6G left.fa.K25.stats > left.fa.K25.stats.sort
CMD: /booleanfs/sysapps/coreutilsv8.29/bin/sort --parallel=16 -k5,5 -T . -S 6G right.fa.K25.stats > right.fa.K25.stats.sort
CMD finished (0 seconds)
CMD finished (0 seconds)
CMD: touch left.fa.K25.stats.sort.ok
CMD finished (0 seconds)
CMD: /booleanfs/apps/trinityrnaseq-devel/util/..//util/support_scripts//nbkc_merge_left_right_stats.pl --left left.fa.K25.stats.sort --right right.fa.K25.stats.sort --sorted > pairs.K25.stats
-opening left.fa.K25.stats.sort
-opening right.fa.K25.stats.sort
-done opening files.
CMD finished (0 seconds)
Error, pairs.K25.stats is empty. Be sure to check your fastq reads and ensure that the read names are identical except for the /1 or /2 designation. at /booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normalization.pl line 921.
Error, cmd: /booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normalization.pl --seqType fq --JM 12G --max_cov 50 --min_cov 1 --CPU 16 --output /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_K/insilico_read_normalization --max_pct_stdev 10000 --left /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_K_1.fastq --right /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_K_2.fastq --pairs_together --PARALLEL_STATS died with ret 512 at /booleanfs/apps/trinityrnaseq-devel/Trinity line 2578.
main::process_cmd("/booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normal"...) called at /booleanfs/apps/trinityrnaseq-devel/Trinity line 3124
main::normalize("/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinit"..., 50, ARRAY(0x1555d30), ARRAY(0x1555d60)) called at /booleanfs/apps/trinityrnaseq-devel/Trinity line 3071
main::run_normalization(50, ARRAY(0x1555d30), ARRAY(0x1555d60)) called at /booleanfs/apps/trinityrnaseq-devel/Trinity line 1291
Trinity failed for locus
##BCR_L##

 ______  ____   ____  ____   ____  ______  __ __
|      ||    \ |    ||    \ |    ||      ||  |  |
|      ||  D  ) |  | |  _  | |  | |      ||  |  |
|_|  |_||    /  |  | |  |  | |  | |_|  |_||  ~  |
  |  |  |    \  |  | |  |  | |  |   |  |  |___, |
  |  |  |  .  \ |  | |  |  | |  |   |  |  |     |
  |__|  |__|\_||____||__|__||____|  |__|  |____/

Left read files: $VAR1 = [
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_L_1.fastq'
];
Right read files: $VAR1 = [
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_L_2.fastq'
];
Trinity version: BLEEDING_EDGE
** NOTE: Latest version of Trinity is Trinity-v2.6.5, and can be obtained at:
https://github.com/trinityrnaseq/trinityrnaseq/releases

Tuesday, February 13, 2018: 23:22:31 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /booleanfs/apps/trinityrnaseq-devel/util/support_scripts/ExitTester.jar 0
Tuesday, February 13, 2018: 23:22:31 CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /booleanfs/apps/trinityrnaseq-devel/util/support_scripts/ExitTester.jar 1
Tuesday, February 13, 2018: 23:22:31 CMD: mkdir -p /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_L
Tuesday, February 13, 2018: 23:22:31 CMD: mkdir -p /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/chrysalis

# running normalization on reads: $VAR1 = [
[
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_L_1.fastq'
],
[
'/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_L_2.fastq'
]
];

Tuesday, February 13, 2018: 23:22:31 CMD: /booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normalization.pl --seqType fq --JM 12G --max_cov 50 --min_cov 1 --CPU 16 --output /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/insilico_read_normalization --max_pct_stdev 10000 --left /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_L_1.fastq --right /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_L_2.fastq --pairs_together --PARALLEL_STATS
Converting input files. (both directions in parallel)CMD: seqtk-trinity seq -A /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_L_1.fastq >> left.fa
CMD: seqtk-trinity seq -A /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_L_2.fastq >> right.fa
CMD finished (0 seconds)
CMD finished (0 seconds)
CMD: touch left.fa.ok
CMD finished (0 seconds)
Done converting input files.CMD: cat left.fa right.fa > both.fa
CMD finished (0 seconds)
CMD: touch both.fa.ok
CMD finished (0 seconds)
-------------------------------------------
----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --
-------------------------------------------

done parsing 13066 Kmers, 13066 added, taking 0 seconds.

done parsing 13066 Kmers, 13066 added, taking 0 seconds.
STATS_GENERATION_TIME: 0 seconds.
CMD finished (0 seconds)
STATS_GENERATION_TIME: 0 seconds.
CMD finished (0 seconds)
CMD: touch left.fa.K25.stats.ok
CMD finished (0 seconds)
-sorting each stats file by read name.
CMD: /booleanfs/sysapps/coreutilsv8.29/bin/sort --parallel=16 -k5,5 -T . -S 6G left.fa.K25.stats > left.fa.K25.stats.sort
CMD: /booleanfs/sysapps/coreutilsv8.29/bin/sort --parallel=16 -k5,5 -T . -S 6G right.fa.K25.stats > right.fa.K25.stats.sort
CMD finished (0 seconds)
CMD finished (0 seconds)
CMD: touch left.fa.K25.stats.sort.ok
CMD finished (0 seconds)
CMD: /booleanfs/apps/trinityrnaseq-devel/util/..//util/support_scripts//nbkc_merge_left_right_stats.pl --left left.fa.K25.stats.sort --right right.fa.K25.stats.sort --sorted > pairs.K25.stats
-opening left.fa.K25.stats.sort
-opening right.fa.K25.stats.sort
-done opening files.
CMD finished (0 seconds)
Error, pairs.K25.stats is empty. Be sure to check your fastq reads and ensure that the read names are identical except for the /1 or /2 designation. at /booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normalization.pl line 921.
Error, cmd: /booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normalization.pl --seqType fq --JM 12G --max_cov 50 --min_cov 1 --CPU 16 --output /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinity_output/Trinity_cell1_BCR_L/insilico_read_normalization --max_pct_stdev 10000 --left /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_L_1.fastq --right /booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/aligned_reads/cell1_BCR_L_2.fastq --pairs_together --PARALLEL_STATS died with ret 512 at /booleanfs/apps/trinityrnaseq-devel/Trinity line 2578.
main::process_cmd("/booleanfs/apps/trinityrnaseq-devel/util/insilico_read_normal"...) called at /booleanfs/apps/trinityrnaseq-devel/Trinity line 3124
main::normalize("/booleanfs/apps/Python3_pkgs/bracer/test/results/cell1/Trinit"..., 50, ARRAY(0xf14df0), ARRAY(0xf14dd8)) called at /booleanfs/apps/trinityrnaseq-devel/Trinity line 3071
main::run_normalization(50, ARRAY(0xf14df0), ARRAY(0xf14dd8)) called at /booleanfs/apps/trinityrnaseq-devel/Trinity line 1291
Trinity failed for locus
No successful Trinity assemblies
##No recombinants found##

Please include version information for bracer

It will be convenient if we can get the version used using:

$ bracer --version

teichlab / bracer Goto Github PK

bracer's People

Contributors

Stargazers

Watchers

Forkers

bracer's Issues

What I need help with:

I set up bracer through downloading the docker image directly, but ran error with test data as following. Do you have any suggestions for it?

-------------- Trinity Phase 1: Clustering of RNA-Seq Reads ---------------------

----------- Jellyfish -------------------- -- (building a k-mer catalog from reads) --

--------------- Inchworm --------------------- -- (Linear contig construction from k-mers) --

-------------------- Chrysalis ------------------------- -- (Contig Clustering & de Bruijn Graph Construction) --

------------ Trinity Phase 2: Assembling Clusters of Reads ---------------------

-------------- Trinity Phase 1: Clustering of RNA-Seq Reads ---------------------

----------- Jellyfish -------------------- -- (building a k-mer catalog from reads) --

--------------- Inchworm --------------------- -- (Linear contig construction from k-mers) --

-------------------- Chrysalis ------------------------- -- (Contig Clustering & de Bruijn Graph Construction) --

------------ Trinity Phase 2: Assembling Clusters of Reads ---------------------

-------------- Trinity Phase 1: Clustering of RNA-Seq Reads ---------------------

----------- Jellyfish -------------------- -- (building a k-mer catalog from reads) --

--------------- Inchworm --------------------- -- (Linear contig construction from k-mers) --

-------------------- Chrysalis ------------------------- -- (Contig Clustering & de Bruijn Graph Construction) --

------------ Trinity Phase 2: Assembling Clusters of Reads ---------------------

Recommend Projects

Recommend Topics

Recommend Org

----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --

--------------- Inchworm ---------------------
-- (Linear contig construction from k-mers) --

-------------------- Chrysalis -------------------------
-- (Contig Clustering & de Bruijn Graph Construction) --

----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --

--------------- Inchworm ---------------------
-- (Linear contig construction from k-mers) --

-------------------- Chrysalis -------------------------
-- (Contig Clustering & de Bruijn Graph Construction) --

----------- Jellyfish --------------------
-- (building a k-mer catalog from reads) --

--------------- Inchworm ---------------------
-- (Linear contig construction from k-mers) --

-------------------- Chrysalis -------------------------
-- (Contig Clustering & de Bruijn Graph Construction) --