Contains a set of Galaxy Tools mostly written by the Galaxy Team.
This repo contains a subset of Galaxy tools used in the Tool Shed (https://toolshed.g2.bx.psu.edu/) mostly created by the Galaxy Team (devteam).
The repo's main goals are to:
If you want to contribute to this repository, please see file CONTRIBUTING.md.
Wrapping tools for use in Galaxy is easy! If you want to start, please see our wiki.
Other repositories with high quality tools:
Submitting BWA output directly to this tool, without using SortSAM first, produces an error. There is no warning on the tool for that SortSam is required before use. And there is an option to specify that the inputs are unsorted. One of these should be probably be modified to help users understand how to use the tool.
See other issue for sam_merge for the type of output produced by the error and the tool version (issue #158)
Packages presently on the ToolShed:
package_bowtie_0_12_7 (devteam)
package_bowtie_1_0_0 (iuc)
package_bowtie2_2_1_0 (devteam)
package_bowtie_2_2_4 (devteam)
I think the latter should be renamed to package_bowtie2_2_2_4 for consistency and also because the package name specified inside tool_dependencies.xml is bowtie2:
<package name="bowtie2" version="2.2.4">
Repo does not exist ../tools-devteam/tools/bwa_0_7_10
Repo does not exist ../tools-devteam/packages/package_bwa_0_7_10_039ea20639
I wonder if we are missing any repo updates from that same window - further research is needed but less be careful when uploading to tool shed.
Description is in this biostars post. Replicated on Main by jen. To replicate as well, just use the example data. Fails for both a browsed/loaded len file or for one that is pasted in.
# Cuffcompare v2.2.1 | Command line was:
-#cuffcompare -o cc_output -r /home/gvandeweyer/galaxy-dist/galaxy-dist/database/files/000/dataset_193.dat -e 100 -d 100 ./input1 ./input2
+#cuffcompare -o cc_output -r /tmp/tmp1aKqT7files/000/dataset_3.dat -R -e 100 -d 100 ./input1 ./input2
#
#= Summary for dataset: ./input1 :
# Query mRNAs : 50 in 50 loci (0 multi-exon transcripts)
# (0 multi-transcript loci, ~1.0 transcripts per locus)
-# Reference mRNAs : 9 in 6 loci (9 multi-exon)
+# Reference mRNAs : 1 in 1 loci (1 multi-exon)
# Super-loci w/ reference transcripts: 1
#--------------------| Sn | Sp | fSn | fSp
- Base level: 0.3 2.3 - -
+ Base level: 2.2 2.3 - -
Exon level: 0.0 0.0 0.0 0.0
Intron level: 0.0 -nan 0.0 -nan
Intron chain level: 0.0 -nan 0.0 -nan
@@ -18,33 +18,16 @@
Matching intron chains: 0
Matching loci: 0
- Missed exons: 36/37 ( 97.3%)
+ Missed exons: 2/3 ( 66.7%)
Novel exons: 49/50 ( 98.0%)
- Missed introns: 32/32 (100.0%)
- Missed loci: 5/6 ( 83.3%)
+ Missed introns: 2/2 (100.0%)
+ Missed loci: 0/1 ( 0.0%)
Novel loci: 49/50 ( 98.0%)
#= Summary for dataset: ./input2 :
# Query mRNAs : 50 in 50 loci (0 multi-exon transcripts)
# (0 multi-transcript loci, ~1.0 transcripts per locus)
-# Reference mRNAs : 8 in 5 loci (8 multi-exon)
-# Super-loci w/ reference transcripts: 0
-#--------------------| Sn | Sp | fSn | fSp
- Base level: 0.0 0.0 -
If there is no cuffmerge or cufflinks binary - these wrappers still reports the dataset as in an 'ok' state - though the peak text makes it clear the tool did not run.
It would probably be best to just do away with the wrapper altogether like cuffquant for instance.
Is the .sample definition for tool_data_table_conf.xml wrong in a number of vcflib tools, for example
The definition for that index file has had 4 columns vs. the 3 defined in those .sample files (see https://github.com/galaxyproject/usegalaxy-playbook/blob/master/files/galaxy/usegalaxy.org/config/tool_data_table_conf.xml#L143).
I love the migration to github, I love the big repo, and in particular I love that we now have a process for the cufflinks additions and the bowtie fixes! This isn't meant to backtrack on that - but actually move the idea forward even a step more.
If these tools are going to see a lot of activity (seems a reasonable assumption) moving them to their own repository would allow us to use planemo's Travis integration to pre-test pull requests and ensure things stay green before they even hit the test toolshed. (Here is an example of the Travis integration for bwa-mem - results here). It is very much modeled after @peterjc work on this.
There are a lot of downsides - it means decreased visibility for these tools in a way (or would it increase it) - less prestige I guess related to pull requests at least. The other downsides is everything we said about it being nice to grep through all of these tools at once, etc... - it diminishes tools-devteam to take some of the highest profile tools out of it.
fasta_clipping_histogram.pl requires Perl (non-core) modules GD::Graph::bars and PerlIO::gzip.
fastq_quality_boxplot_graph.sh requires gnuplot. This can be satisfied by package_gnuplot_4_6 in galaxyproject_tools-iuc repository.
Both scripts are used by tools in tool_collections/fastx_toolkit/.
Hi,
I get the following errror using HISAT with a paired data collection.
Traceback (most recent call last):
File "/usr/local/galaxy/galaxy-dist/lib/galaxy/jobs/runners/__init__.py", line 163, in prepare_job
job_wrapper.prepare()
File "/usr/local/galaxy/galaxy-dist/lib/galaxy/jobs/__init__.py", line 858, in prepare
self.command_line, self.extra_filenames = tool_evaluator.build()
File "/usr/local/galaxy/galaxy-dist/lib/galaxy/tools/evaluation.py", line 411, in build
self.__build_command_line( )
File "/usr/local/galaxy/galaxy-dist/lib/galaxy/tools/evaluation.py", line 427, in __build_command_line
command_line = fill_template( command, context=param_dict )
File "/usr/local/galaxy/galaxy-dist/lib/galaxy/util/template.py", line 9, in fill_template
return str( Template( source=template_text, searchList=[context] ) )
File "/usr/local/galaxy/galaxy-dist/eggs/Cheetah-2.2.2-py2.7-linux-x86_64-ucs2.egg/Cheetah/Template.py", line 1004, in __str__
return getattr(self, mainMethName)()
File "cheetah_DynamicallyCompiledCheetahTemplate_1434276434_44_12951.py", line 115, in respond
File "/usr/local/galaxy/galaxy-dist/lib/galaxy/tools/wrappers.py", line 364, in __getattr__
return self.__element_instances[ key ]
File "/usr/local/galaxy/galaxy_env/lib/python2.7/UserDict.py", line 23, in __getitem__
raise KeyError(key)
KeyError: 'forward'
The weblogo3 tool was failing for us, with the rgWebLogo.py wrapper reporting that weblogo was returning exit code 1. At the command line I duplicated the job environment and dependency shell commands and was able to reproduce the error:
## rgWebLogo3.py error - executing weblogo -F jpeg -c auto -o /home/galaxy/tmp/logo.jpg -U bits -t "test" -f /home/galaxy/tmp/test.fasta -s medium returned error code 1
## This may be a data problem or a tool dependency (weblogo) installation problem
## Please ensure weblogo is correctly installed and working on the command line -see http://code.google.com/p/weblogo
I then tried running the above weblogo command directly:
Traceback (most recent call last):
File "/mnt/scdata/scdata_03/galaxy/containers/galaxy-qa/tool_deps/weblogo/3.3/devteam/package_weblogo_3_3/648e4b32f15c/weblogo", line 56, in <module>
import weblogolib._cli
File "/mnt/scdata/scdata_03/galaxy/containers/galaxy-qa/export/tool_deps/weblogo/3.3/devteam/package_weblogo_3_3/648e4b32f15c/weblogolib/__init__.py", line 108, in <module>
from numpy import array, asarray, float64, ones, zeros, int32,all,any, shape
ImportError: No module named numpy
As a quick fix, I added a package dependency requirement for numpy to rgWebLogo3.xml and reloaded the tool in Galaxy, after which the tool worked properly.
Duplication is desired? This may be confusing for end users. Both samtools and picard are nearly always installed in locals as the first go-to tool packages.
The tool_dependencies.xml file for freebayes installs the freebayes binary into the INSTALL_DIR, however, the PATH is set to INSTALL_DIR/bin.
<destination_directory>$INSTALL_DIR</destination_directory>
...
<environment_variable name="PATH" action="prepend_to">$INSTALL_DIR/bin</environment_variable>
The weblogo3 tool is failing with the following generic error on Galaxy Main (as well as our local instance) when the "Text" output format is selected:
## rgWebLogo3.py error - executing weblogo -F txt -c auto -o /galaxy-repl/main/files/011/411/dataset_11411895.dat -U bits -t "Galaxy-Rgenetics Sequence Logo" -f /galaxy-repl/main/files/011/411/dataset_11411891.dat -s large returned error code 2
## This may be a data problem or a tool dependency (weblogo) installation problem
## Please ensure weblogo is correctly installed and working on the command line -see http://code.google.com/p/weblogo
On our instance I replicated the job environment and ran weblogo by hand:
$ weblogo -F txt -c auto -o output.dat -U bits -t "Galaxy-Rgenetics Sequence Logo" -f dataset_8485.dat -s large
Usage: weblogo [options] < sequence_data.fa > sequence_logo.eps
weblogo: error: option -F: invalid choice: 'txt' (choose from 'svg', 'eps', 'jpeg', 'pdf', 'png_print', 'logodata', 'png')
It looks like the option tag for text output in rgWebLogo3.xml should have the value attribute logodata rather than txt.
As an aside, debugging issues with this tool (see also #65) is made more difficult by the omission of weblogo's stdout/stderr in the error message. That output is captured and stored, but is not included in the error message before the early call to sys.exit in the rgWebLogo3.runCL function.
During the complete rewrite of Picard wrappers in pull request #34, picard_BamIndexStats.xml and rgPicardHsMetrics.xml tools were removed. Since both are still useful, they should be re-added.
When using the date tag (DT) in the format specified on the BWA tool form for read group info, this tool produces an error dataset. Clicking on the bug icon contains this error. Similar to error for MergeSAMFiles (issue #157). Related to other issues with this same tool (not recognizing unsorted input even though the checkbox specifying unsorted input is used) - in issue #159)
Fatal error: Matched on error: [Mon Jun 15 23:55:53 UTC 2015] net.sf.picard.sam.MergeSamFiles INPUT=[/mnt/galaxy/files/000/dataset_216.dat, /mnt/galaxy/files/000/dataset_217.dat] OUTPUT=/mnt/galaxy/files/000/dataset_218.dat MERGE_SEQUENCE_DICTIONARIES=true TMP_DIR=[/mnt/galaxy/tmp] VALIDATION_STRINGENCY=LENIENT SORT_ORDER=coordinate ASSUME_SORTED=false USE_THREADING=false VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false [Mon Jun 15 23:55:53 UTC 2015] Executing as galaxy@w3 on Linux 3.13.0-44-generic amd64; Java HotSpot(TM) 64-Bit Server VM 1.7.0_80-b15 Ignoring SAM validation error: WARNING: File /mnt/galaxy/files/000/dataset_216.dat, Error parsing SAM header. DT tag value '$rg.DT' is not parseable as a date. Line: @RG ID:one SM:one PL:ILLUMINA LB:$rg.LB CN:$rg.CN DS:$rg.DS DT:$rg.DT PU:$rg.PU Ignoring SAM validation error: ERROR: File /mnt/galaxy/files/000/dataset_216.dat, Error parsing SAM header. Problem parsing @PG key:value pair ID:one clashes with ID:bwa. Line: @PG ID:bwa PN:bwa VN:0.7.10-r876-dirty CL:bwa sampe -r @RG ID:one SM:one PL:ILLUMINA LB:$rg.LB CN:$rg.CN DS:$rg.DS DT:$rg.DT PU:$rg.PU /mnt/galaxyIndices/hg19/bwa_mem_index/hg19/hg19.fa first.sai second.sai /mnt/galaxy/files/000/dataset_113.dat /mnt/galaxy/files/000/dataset_114.dat Ignoring SAM validation error: WARNING: File /mnt/galaxy/files/000/dataset_217.dat, Error parsing SAM header. DT tag value '$rg.DT' is not parseable as a date. Line: @RG ID:two SM:two PL:ILLUMINA LB:$rg.LB CN:$rg.CN DS:$rg.DS DT:$rg.DT PU:$rg.PU Ignoring SAM validation error: ERROR: File /mnt/galaxy/files/000/dataset_217.dat, Error parsing SAM header. Problem parsing @PG key:value pair ID:two clashes with ID:bwa. Line: @PG ID:bwa PN:bwa VN:0.7.10-r876-dirty CL:bwa sampe -r @RG ID:two SM:two PL:ILLUMINA LB:$rg.LB CN:$rg.CN DS:$rg.DS DT:$rg.DT PU:$rg.PU /mnt/galaxyIndices/hg19/bwa_mem_index/hg19/hg19.fa first.sai second.sai /mnt/galaxy/files/000/dataset_115.dat /mnt/galaxy/files/000/dataset_116.dat INFO 2015-06-15 23:55:53 MergeSamFiles Input files are in same order as output so sorting to temp directory is not needed. INFO 2015-06-15 23:55:57 MergeSamFiles Finished reading inputs. [Mon Jun 15 23:55:57 UTC 2015] net.sf.picard.sam.MergeSamFiles done. Elapsed time: 0.06 minutes. Runtime.totalMemory()=236453888
Galaxy Tool Version 1.2.0
We run our own custom galaxy instance in the Amazon Cloud and I am updating our instance with the latest toolshed files. For cuffmerge, in past revisions, we would just have a button to add another GTF input. However, this latest one (10:b6e3849293b1) that has been replaced with a multi-select. We also have a few built-in genomes that we use with cuffmerge. When I choose the first GTF file (using locally cached sequence data) it will populate the reference genome correctly with our built-in genomes. However, once I choose more than one GTF file, I get one of two errors:
No reference genome is available for the build associated with the selected input dataset
OR
An invalid option was selected, please verify
The built-in genomes are definitely there and available for cuffmerge, and each of the GTF files have the correct database build associated with them, but for some reason choosing more than one GTF file in the multi-select causes an error. Is this a bug or am I doing something wrong?
Should we move samtool_filter2 to the other samtools wrapper? Would be worth to update it and stick it into a samtools suite. Comments? @nekrut ?
Most tools do not require modifications - but tools that should consume pairs of datatsets should probably be updated to allow paired inputs via a <data_collection collection_type="paired"... parameter and tools that do reductions over datasets should be reworked to use multiple="true" data inputs or augmented to allow data_collection parameters.
Tools Consuming Pairs
tophat2bowtie2bwa (maybe...)fastq_paired_end_deinterlacer, fastq_paired_end_interlacer, fastq_paired_end_joiner, fastq_paired_end_splitter.Dataset Reduction Tools
cuff*Currently listed as requiring 'ucsc_tools', needs to have TS installable package that provides the 'faToTwoBit' executable.
Related to #157 and #158. Most likely exists in other tools from this revision/package.
Green "success" dataset with this in the info field:
Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m Ignoring SAM validation error: WARNING: Error parsing SAM header. DT tag value '$rg.DT' is not parseable as a date. Line: @RG ID:one PL:ILLUMINA PU:$rg.PU LB:$rg.LB DS:$rg.DS DT:$rg.DT SM:one CN:$rg.CN Ignoring
For example, bamtools filter uses images in the documentation but the url is not properly constructed:
<img alt="/repository/static/images/59bc5dbe6dfc6d4c//static%2Fimages%2Fsingle-filter.png" src="/repository/static/images/59bc5dbe6dfc6d4c//static%2Fimages%2Fsingle-filter.png">Removing static%2Fimages%2F shows the image properly. Also when installed this static%2Fimages%2F should be removed to be able to show the image.
Removing ${static_path} from the .xml solves the issue. Also, the documentation has no mentioning of this and the way stated in the documentation just works (https://wiki.galaxyproject.org/DefiningImagesInToolConfigs).
.. image:: single-filter.png
Note: static_enabled = False/True does not seem to have any effect on this
Sync the behaviour of picard_FastqToSam.xml, picard_MarkDuplicatesWithMateCigar.xml and picard_AddCommentsToBam.xml, picard_MarkDuplicates.xml and picard_MergeSamFiles.xml in COMMENT handling.
See: #149
The issue is that the FastqReader class parses the entire "@" line as a sequence id. The specification actually allows for an "optional" description, similar to FASTA which comes after a space. Some files I have seen (such as those from the iMicrobe Project) contain lines like:
@<READID> <DESCRIPTION>
ATCGGTTTCGTTGTGTTATTCGCGGCCAAGGGTTTTGTCGTCGTTATATT
+<READID>
^__ec\cccgce]`J[R`[[`ee][ccecag__aafU\baT_WLY^\Xac
These result in the following error:
Exception: Invalid FASTQ file: could not find quality score of sequence identifier @<READID> <DESCRIPTION>.
I believe this would be a simple fix, however, I'm not actually sure where the code for those utility classes is hosted.
when I run planemo test (using samtools 1.2) on this tool https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/samtools/samtools_phase
I get this test error report: www.googledrive.com/host/0BycJJtbagAMTd2V2UzVURDRRQUE
ping @nekrut
planemo run test report:
www.googledrive.com/host/0BycJJtbagAMTQThZdlI2VXAySm8
ping @nekrut
When tools (e.g. MACS14) attempt to use R from this package, I get an error regarding libreadline.so.6. This is on a CentOS5 system. I can reproduce the error attempting to run R from the command line. Perhaps the LDFLAGS weren't set correctly when the binaries were built?
> source ./tool-dependencies/R/2.15.0/devteam/package_r_2_15_0/6c34eaa82fed/env.sh
> R
> R: error while loading shared libraries: libreadline.so.6: cannot open shared object file: No such file or directory
It seems like the tools in the vcftools collection require both bgzip and tabix (see e.g. https://github.com/galaxyproject/tools-devteam/blob/master/tool_collections/vcftools/vcftools_subset/vcftools_subset.xml). However, they are not installed as a dependency from the ToolShed. Are these tools that should be installed on the galaxy user's path, or is this simply a dependency oversight?
In file https://github.com/galaxyproject/tools-devteam/blob/master/tools/clustalw/rgClustalw.xml#L68 clustal and phylip are used as possible output formats, but are not defined either in Galaxy or in this tool repository.
I believe the issue is caused if the genome index is already built or it handles multiple fasta files during index building.
During multiple fasta file index building, if the basename of the index files is the same it fails. ( i'm guessing this should fail). But if the index already exists on the galaxy instance, it should just tell us that it exists and not build the index again..
The error below is because of same index being built again, or simultaneously
Fatal error: Exit code 1 () Error: could not open /mnt/transient_nfs/tmp/job_working_directory/000/58/dataset_58_files/ce10.fa Error: Encountered internal Bowtie 2 exception (#1) Command: bowtie2-build --wrapper basic-0 /mnt/transient_nfs/tmp/job_working_directory/000/58/dataset_58_files/ce10.fa ce10,ce10,ce10,ce10 Error building index.
python /mnt/galaxy/shed_tools/toolshed.g2.bx.psu.edu/repos/devteam/data_manager_bowtie2_index_builder/9458af1ab90b/data_manager_bowtie2_index_builder/data_manager/bowtie2_index_builder.py "/mnt/galaxy/files/000/dataset_58.dat" --fasta_filename "/mnt/galaxyIndices/ce10/seq/ce10.fa,/mnt/galaxyIndices/ce10/seq/ce10.fa,/mnt/galaxyIndices/ce10/seq/ce10.fa,/mnt/galaxyIndices/ce10/seq/ce10.fa" --fasta_dbkey "ce10,ce10,ce10,ce10" --fasta_description "C. elegans Oct. 2010 (WS220/ce10) (ce10),C. elegans Oct. 2010 (WS220/ce10) (ce10),C. elegans Oct. 2010 (WS220/ce10) (ce10),C. elegans Oct. 2010 (WS220/ce10) (ce10)" --data_table_name "bowtie2_indexes"
... if also collecting unaligned reads.
After installing the latest bowtie2 wrapper from the toolshed, I get a "permission denied" error when trying to run the tool. I believe this is due to the fact that the bowtie2 executable does not have the executable bit set:
-rw-r--r-- 1 galaxy galaxy 17969 Dec 16 16:30 tool-dependencies/bowtie2/2.2.4/devteam/package_bowtie_2_2_4/2b25b6e8d108/bowtie2
When using the date tag (DT) in the format specified on the BWA tool form for read group info, this tool produces a successful dataset, but in the comments this appears. Similar to error for Merge BAM Files.
Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m Ignoring SAM validation error: WARNING: File /mnt/galaxy/files/000/dataset_216.dat, Error parsing SAM header. DT tag value '$rg.DT' is not parseable as a date. Line: @RG ID:one SM:one PL:ILLUMINA LB:$rg.LB CN:
Galaxy Tool Version 1.126.0
Minnesota researchers want a galaxy tool for the cufflinks gffread command. The tool is available currently from: https://testtoolshed.g2.bx.psu.edu/view/jjohnson/gffread
Would there be any interest in adding this in the devteam all_cufflinks_tool_suite?
Or the IUC tools?
reported by @jennaj
Make greater use of macros to further harmonize BWA and BWA-mem wrappers - including read group handling (see comments on #52).
403 error when attempting to download: https://depot.galaxyproject.org/package/linux/x86_64/bowtie2/bowtie2-2.2.4-linux-x86_64.zip
FastQC needs a small rewrite to get rid of the python file, which is not needed imho.
On bwa and bwa-mem the error at the end of this ticket appears in the stderr. Process seems to finish correctly.
Galaxy Tool ID: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.1
Revision: c71dd035971e
Job Command-Line:
ln -s "/g/galaxy/galaxy-dev_data/files/009/dataset_9059.dat" "localref.fa" && ( size=`stat -c %s "localref.fa" 2>/dev/null`; if [ $? -eq 0 ]; then if [ $size -lt 2000000000 ]; then bwa index -a is "localref.fa"; else bwa index -a bwtsw "localref.fa"; fi; fi; eval $(stat -s "localref.fa"); if [ $? -eq 0 ]; then if [ $st_size -lt 2000000000 ]; then bwa index -a is "localref.fa"; echo "Generating BWA index with is algorithm"; else bwa index -a bwtsw "localref.fa"; echo "Generating BWA index with bwtsw algorithm"; fi; fi; ) && bwa aln -t "${GALAXY_SLOTS:-1}" -b -0 "localref.fa" "/g/galaxy/galaxy-dev_data/files/008/dataset_8792.dat" > first.sai && bwa samse "localref.fa" first.sai "/g/galaxy/galaxy-dev_data/files/008/dataset_8792.dat" | samtools view -Sb - > temporary_bam_file.bam && samtools sort -f temporary_bam_file.bam /g/galaxy/galaxy-dev_data/files/009/dataset_9061.datInput Parameter: Value Note for rerun
Load reference genome from history
Use the following dataset as the reference sequence 1: UCSC Main on Mouse: refGene (chr12:1-121257530)
Select input type: single_bam
Select BAM dataset: 2: Downsample_KO
Set advanced single end options?: do_not_set
Set readgroups information?: do_not_set
Select analysis mode: illumina
_Error_:
[bwa_index] Pack FASTA... 0.58 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 23.55 seconds elapse.
[bwa_index] Update BWT... 0.40 sec
[bwa_index] Pack forward-only FASTA... 0.34 sec
[bwa_index] Construct SA from BWT and Occ... 11.21 sec
[main] Version: 0.7.10-r876-dirty
[main] CMD: bwa index -a is localref.fa
[main] Real time: 38.455 sec; CPU: 36.091 sec
stat: invalid option -- 's'
Try `stat --help' for more information.
/g/galaxy/galaxy-dev_data/job_working_directory/005/5943/galaxy_5943.sh: line 35: [: -lt: unary operator expected
[bwa_index] Pack FASTA... 0.54 sec
[bwa_index] Construct BWT for the packed sequence...
[BWTIncCreate] textLength=127596972, availableWord=20977816
[BWTIncConstructFromPacked] 10 iterations done. 34603372 characters processed.
[BWTIncConstructFromPacked] 20 iterations done. 63925708 characters processed.
[BWTIncConstructFromPacked] 30 iterations done. 89983420 characters processed.
[BWTIncConstructFromPacked] 40 iterations done. 113139548 characters processed.
[bwa_index] 56.18 seconds elapse.
[bwa_index] Update BWT... 0.38 sec
[bwa_index] Pack forward-only FASTA... 0.34 sec
[bwa_index] Construct SA from BWT and Occ... 11.34 sec
[main] Version: 0.7.10-r876-dirty
[main] CMD: bwa index -a bwtsw localref.fa
[main] Real time: 70.975 sec; CPU: 68.787 sec
[W::sam_hdr_parse] duplicated sequence 'mm9_refGene_NM_011899'
[W::sam_hdr_parse] duplicated sequence 'mm9_refGene_NM_001100116'
[W::sam_hdr_parse] duplicated sequence 'mm9_refGene_NM_028527'
[W::sam_hdr_parse] duplicated sequence 'mm9_refGene_NM_001177573'
[W::sam_hdr_parse] duplicated sequence 'mm9_refGene_NM_001166062'
[W::sam_hdr_parse] duplicated sequence 'mm9_refGene_NM_178657'
[main] Version: 0.7.10-r876-dirty
[main] CMD: bwa mem -t 1 -v 1 localref.fa /g/galaxy/galaxy-dev_data/files/009/dataset_9065.dat
[main] Real time: 47.632 sec; CPU: 39.081 sec
Download url on MACS2 wrapper seems invalid, this maybe?
https://github.com/modENCODE-DCC/Galaxy/raw/master/modENCODE_DCC_tools/macs2/2.0.10.2.tar
Nevermind - its not ours, sorry.
Unable to install Cufflinks 2.1.1 from package_cufflinks_2_1_1.
Error downloading from URL
http://cufflinks.cbcb.umd.edu/downloads/cufflinks-2.1.1.tar.gz:
HTTP Error 404: Not Found
Looks like the new URL should be http://cole-trapnell-lab.github.io/cufflinks/assets/downloads/cufflinks-2.1.1.tar.gz
There is no .shed.yml file in tools/cummeRbund/. I would add one, but I'm not sure if we want to (and can) reuse jjohnson's Tool Shed repository.
The purpose of this option "unsorted" is unclear. From what I can tell, the dataset is unchanged. Could we clarify what the purpose of the option is in the tool form? Is it a needed option but not functional yet?
Also, samtools_sort does the same operations (without the "unsorted" option) and succeeds with both coordinate and read name options. Users will probably install both picard and samtools as complete packages. Do we need both of these tools? Or should one be retained to avoid user confusion?
Galaxy Tool Version 1.126.0
Duplicated tools. Do we need both?
See related duplicated tool issue and comments: #162
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
Django
The Web framework for perfectionists with deadlines.
Laravel
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
Microsoft
Open source projects and samples from Microsoft.
Google
Google ❤️ Open Source for everyone.
Alibaba
Alibaba Open Source for everyone
D3
Data-Driven Documents codes.
Tencent
China tencent open source team.