benjschiller / twobitreader

A fast python class for reading 2-bit files (used by UCSC genome browser)

twobitreader is a fast python package for reading .2bit files (used by UCSC genome browser)

To install, run

python setup.py install

Can be run as a script

python -m twobitreader example.2bit < example.bed

Or imported as a module ("twobitreader")

Licensed under Perl Artistic License 2.0

No warranty is provided, express or implied

twobitreader's Issues

Invalid nucleotides for last chromosome

Using the following reference genome:

>FIRST_CHR
ACGTACGTACGTACGTACGTACGTACGTA
>LAST_CHR
AAAGGGGGGC

The entire sequence of "LAST_CHR" is correct:

>>> reader['LAST_CHR'][0:9]
'AAAGGGGGG'

But extracting nucleotides from the end of "LAST_CHR" returns wrong nucleotides:

>>> reader = twobitreader.TwoBitFile("genome.2bit")
>>> reader['LAST_CHR'][5:6]
'A'
>>> reader['LAST_CHR'][6:9]
'AAA'