lattice-automation / primers Goto Github PK
View Code? Open in Web Editor NEWA PCR primer tool for DNA assembly flows
License: MIT License
A PCR primer tool for DNA assembly flows
License: MIT License
opt_tm: float = 62.0
opt_gc: float = 0.5
opt_len: int = 22
penalty_tm: float = 1.0
penalty_gc: float = 3.0
penalty_len: float = 1.0
penalty_tm_diff: float = 1.0
penalty_dg: float = 2.0
penalty_offtarget: float = 20.0
to
optimal_tm: float = 62.0
optimal_gc: float = 0.5
optimal_len: int = 22
penalty_tm_delta: float = 1.0 # delta from optimal
penalty_gc_delta: float = 3.0
penalty_len_delta: float = 1.0
penalty_dg_delta: float = 2.0
penalty_offtarget: float = 20.0
penalty_pair_tm_delta: float = 1.0 # delta of tm between the pair's primers
to reproduce
wget https://pypi.io/packages/source/p/primers/primers-0.5.4.tar.gz
tar zxvf primer*
cd primers-0.5.4
ls
got me
LICENSE
PKG-INFO
primers
primers.egg-info
README.md
setup.cfg
setup.py
tests
you see there is no requirements.txt
, but setup.py reads it.
thus got me
......
Installing build dependencies ... done
Running command Getting requirements to build wheel
<string>:3: DeprecationWarning: pkg_resources is deprecated as an API. See https://setuptools.pypa.io/en/latest/pkg_resources.html
Traceback (most recent call last):
File "/tmp/primers-0.5.4/.venv/lib/python3.11/site-packages/pip/_vendor/pyproject_hooks/_in_process/_in_process.py", line 353, in <module>
main()
File "/tmp/primers-0.5.4/.venv/lib/python3.11/site-packages/pip/_vendor/pyproject_hooks/_in_process/_in_process.py", line 335, in main
json_out['return_val'] = hook(**hook_input['kwargs'])
^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "/tmp/primers-0.5.4/.venv/lib/python3.11/site-packages/pip/_vendor/pyproject_hooks/_in_process/_in_process.py", line 118, in get_requires_for_build_wheel
return hook(config_settings)
^^^^^^^^^^^^^^^^^^^^^
File "/tmp/pip-build-env-hoe006rw/overlay/lib/python3.11/site-packages/setuptools/build_meta.py", line 325, in get_requires_for_build_wheel
return self._get_build_requires(config_settings, requirements=['wheel'])
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "/tmp/pip-build-env-hoe006rw/overlay/lib/python3.11/site-packages/setuptools/build_meta.py", line 295, in _get_build_requires
self.run_setup()
File "/tmp/pip-build-env-hoe006rw/overlay/lib/python3.11/site-packages/setuptools/build_meta.py", line 487, in run_setup
super().run_setup(setup_script=setup_script)
File "/tmp/pip-build-env-hoe006rw/overlay/lib/python3.11/site-packages/setuptools/build_meta.py", line 311, in run_setup
exec(code, locals())
File "<string>", line 10, in <module>
FileNotFoundError: [Errno 2] No such file or directory: 'requirements.txt'
error: subprocess-exited-with-error
......
the reason why I don't use wheel is that I am packing it to bioconda
conda channel. patching it as temp workaround
This is not a dealbreaker but having the reverse complement method
Line 470 in 92e3e6d
I am getting the following error when trying to run the off-target example:
% primers AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA -t ggaattacgtAATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAAggaccagttacagga
Traceback (most recent call last):
File "/opt/anaconda3/bin/primers", line 8, in
sys.exit(run())
File "/opt/anaconda3/lib/python3.9/site-packages/primers/main.py", line 19, in run
fwd, rev = primers(
File "/opt/anaconda3/lib/python3.9/site-packages/primers/primers.py", line 258, in primers
fwd_primers = _primers(
File "/opt/anaconda3/lib/python3.9/site-packages/primers/primers.py", line 314, in _primers
ot = offtargets(seq, offtarget_check)
File "/opt/anaconda3/lib/python3.9/site-packages/primers/offtargets.py", line 34, in offtargets
for m in mutate(check_seq[s : s + 10]):
File "/opt/anaconda3/lib/python3.9/site-packages/primers/offtargets.py", line 29, in mutate
for m in mutate_map[c]:
KeyError: 'g'
It would be great to be able to score a PCR based on the primers that I specify. Something like this:
primers -t {template} -oligo1 {oligo1_seq} -oligo2 {oligo2_seq}
Thanks,
Joe
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.