Coder Social home page Coder Social logo

g4boost's Introduction

G4Boost

G-quadruplex identification and secondary structure stability prediction tool

G4Boost requires python3.

Prediction models was constructed using the sklearn module. Prebuilt regression and classification models are available through GitHub.

Locate regression and classification models (G4Boost_regressor.json and G4Boost_classifier.json) into the same directory with G4Boost.py

required python packages:
	pandas==1.4.3
	xgboost==1.4.2


Options:
--version             show program's version number and exit  
-h, --help            show this help message and exit
-f FASTA_FILE, --fasta FASTA_FILE
		      Query sequences in fasta format
--classifier JSON_FILE
		      Classification model in .json format [optional]
--regressor JSON_FILE
		      Regression model in .json format [optional]
-N MAX_LOOP_LENGTH, --maxloop MAX_LOOP_LENGTH
		      The maximum number of bases allowed within a loop region [default=12]
-n MIN_LOOP_LENGTH, --minloop MIN_LOOP_LENGTH
		      The minimum number of bases allowed within a loop region [default=1]
-G MAX_G_BASES, --maxG MAX_G_BASES
		      The maximum number of consecutive guanine bases allowed within a G-stem [default=7]
-g MIN_G_BASES, --minG MIN_G_BASES
		      The minimum number of consecutive guanine bases allowed within a G-stem [default=1]
-l NUMBER_OF_LOOPS, --loops NUMBER_OF_LOOPS
		      The maximum number of fleaxible loops separating the G-stems [default=11]
--noreverse
		      Do not search the reverse complement of the input fasta.
-q, --quiet
		      Do not print progress report (i.e. sequence names as they are scanned).

Prepare an input file (FASTA):

head test_sequence.fa
>test_seq_1
GGGCAGAAGGGAGGGCTGGGG

Locate regression and classification models into the same directory with G4Boost.py


To run G4Boost:

python3 G4Boost.py -f test_sequence.fa

The outputs include two files

  1. a gff file for the position of the putative G4s

  2. a csv file for the secondary structure predcition scores

    head test_sequence.fa.gff

    test_seq_1 0 21 test_seq_1_0_21 21 + GGGCAGAAGGGAGGGCTGGGG

head test_sequence.fa.g4scores.csv
seq seq_length g4motif length loops G-quartet maxlbase minlbase G C GG CC g4_pred g4_prob mfe_pred
test_seq_1 21 GGGcagaaGGGaGGGctgGGG 21 3 3 5 1 66 9 42 0 1 0.99999976 -13.413148


To change parameters:

python3 G4Boost.py -f test_sequence.fa --maxloop 7 --minloop 1 --maxG 4 --minG 3 --loops 3 --noreverse --quiet

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.