g4boost's People
g4boost's Issues
Dependancies for python libraries
Please mention in the doc the required version of the packages,
i.e xgboost==1.4.2
, pandas==?
install xgboost with:
pip install xgboost==1.4.2
Provided models G4Boost_classifier.json
& G4Boost_regressor.json
are built on 1.4.2 I had errors with xgboost==1.6
I could run the program with the following.
joblib 1.1.0
numpy 1.23.1
pandas 1.4.3
pip 22.2.2
python-dateutil 2.8.2
pytz 2022.2
scikit-learn 1.1.2
scipy 1.9.0
setuptools 64.0.2
six 1.16.0
threadpoolctl 3.1.0
wheel 0.37.1
xgboost 1.4.2
Modified resulting sequences in CSV
Hello
I am using the package to evaluate potential G4s.
Starting from a fasta file with an entry such as: GGTGGGTAGTTTGACTGGGGCGG
I analyze using
python3 G4Boost.py -f Sequences.fasta --maxloop 20 --minloop 0 --maxG 4 --minG 1 --loops 10 --noreverse --classifier G4Boost_classifier.json --regressor G4Boost_regressor.json
The result is a gff and a csv.
In the gff the results are:
Sequence_1 0 23 Sequence_1_0_23 23 + GGTGGGTAGTTTGACTGGGGCGG
In the csv however, the G4motif is modified and reduced, missing two Gs in the middle of the PQS (the motif goes form a length of 23 to 21).
GGTGGGTAGTTTGACTGGGGCGG --> GGtgGGtagtttgactGGcGG
Is this normal?
Why does this happen? It is changing the sequence.
Is there a way to obtain the G4-pred; G4-prob and mfe-pred of the entire imputed motif? (the 23 length motif and not the 21-long "modified" which is not really what i want to evaluate?)
Also, regarding G4-topology prediction, the algorithm is designed to give the Gs predicted to be part of G-runs (Gs in mayuscules), but not its actual predicted topology (parallel, antiparallel or hybrid), correct?
Thanks for the time
EBR
XGBoostError opening G4Boost_regressor.json failed: no such file or directory
Trying to test the G4boost.py script with defaults and a single file test.fa with 'GGGAGGGTGGGAGGG' as its only contents and received the following:
Processing GGGAGGGTGGGAGGG
Starting stability prediction!
Traceback (most recent call last):
File "/home/shared/G4Boost/G4Boost.py", line 252, in <module>
regressor.load_model(args.regressor)
File "/home/robert/tutorial-env/lib64/python3.6/site-packages/xgboost/sklearn.py", line 599, in load_model
self.get_booster().load_model(fname)
File "/home/robert/tutorial-env/lib64/python3.6/site-packages/xgboost/core.py", line 2170, in load_model
self.handle, c_str(fname)))
File "/home/robert/tutorial-env/lib64/python3.6/site-packages/xgboost/core.py", line 218, in _check_call
raise XGBoostError(py_str(_LIB.XGBGetLastError()))
xgboost.core.XGBoostError: [16:09:15] ../src/common/io.cc:102: Opening G4Boost_regressor.json failed: No such file or directory
Stack trace:
[bt] (0) /home/robert/tutorial-env/lib64/python3.6/site-packages/xgboost/lib/libxgboost.so(+0xc94ed) [0x7fcba139a4ed]
[bt] (1) /home/robert/tutorial-env/lib64/python3.6/site-packages/xgboost/lib/libxgboost.so(+0xc9ada) [0x7fcba139aada]
[bt] (2) /home/robert/tutorial-env/lib64/python3.6/site-packages/xgboost/lib/libxgboost.so(XGBoosterLoadModel+0x379) [0x7fcba136f9b9]
[bt] (3) /lib64/libffi.so.6(ffi_call_unix64+0x4c) [0x7fcbeb921dcc]
[bt] (4) /lib64/libffi.so.6(ffi_call+0x1f5) [0x7fcbeb9216f5]
[bt] (5) /usr/lib64/python3.6/lib-dynload/_ctypes.cpython-36m-x86_64-linux-gnu.so(_ctypes_callproc+0x2a0) [0x7fcbebb34680]
[bt] (6) /usr/lib64/python3.6/lib-dynload/_ctypes.cpython-36m-x86_64-linux-gnu.so(+0x97c6) [0x7fcbebb2d7c6]
[bt] (7) /lib64/libpython3.6m.so.1.0(_PyObject_FastCallDict+0x90) [0x7fcc322eed20]
[bt] (8) /lib64/libpython3.6m.so.1.0(+0x1522fc) [0x7fcc323982fc]
It seems to be looking for the file 'G4Boost_regressor.json' even though that should be an optional argument, correct?
Training Data
I hope this message finds you well. Could you please share the Python script used for data preparation, along with the training data? Having access to these resources would greatly assist me in reproducing your code and analysis.
G4Boost.py only generates gff file and does not generate csv file
HI,
I am trying to run G4boost on a multifasta file, and it generates only the gff file and not the csv file.
What is the different between G4Boost.py and G4Boost_v4.py
Is G4Boost_v4.py the lastest version?
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. ๐๐๐
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google โค๏ธ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.