genedx / pgr-tk Goto Github PK

View Code? Open in Web Editor NEW

88.0 88.0 11.0 1.81 MB

PGR-TK: Pangenome Research Tool Kit

License: MIT License

Shell 0.27% Python 4.01% C 0.01% Rust 95.47% Dockerfile 0.19% HTML 0.04%

pgr-tk's People

Contributors

Stargazers

Watchers

Forkers

cschin huili7 a-khalak sema4-research lixiang117423 schaudge pythseq

pgr-tk's Issues

Install Error Message

Hi,

I want to install and use the **pgr-tk** software, the binary file produces the following error, how can a non-root user fix it? conda After installing, I found out that **pgr-tk** is just a python package and does not work directly from the command line. Please make suggestions, thanks!

(base) [u20111010010@workstation release]$ pgr-pbundle-bed2svg  --help

pgr-pbundle-bed2svg: /usr/lib64/libc.so.6: version GLIBC_2.28' not found (required by pgr-pbundle-bed2svg) pgr-pbundle-bed2svg: /usr/lib64/libc.so.6: version GLIBC_2.25' not found (required by pgr-pbundle-bed2svg)
pgr-pbundle-bed2svg: /usr/lib64/libc.so.6: version GLIBC_2.18' not found (required by pgr-pbundle-bed2svg) pgr-pbundle-bed2svg: /usr/lib64/libc.so.6: version GLIBC_2.33' not found (required by pgr-pbundle-bed2svg)
pgr-pbundle-bed2svg: /usr/lib64/libc.so.6: version GLIBC_2.32' not found (required by pgr-pbundle-bed2svg) pgr-pbundle-bed2svg: /usr/lib64/libc.so.6: version GLIBC_2.34' not found (required by pgr-pbundle-bed2svg)

Best, Du

The Code for plotting Figure 3

Hi,
I want to reproduce the Fig.3 diagram in the main text, is there a corresponding specific code release?

Best,Du

Compilation error

While trying to update the version of pgr-tk distributed via Bioconda we ran into the following error:

2022-10-30T12:11:32.0887989Z 12:11:32 BIOCONDA INFO (OUT)    Compiling cargo-xwin v0.10.2
2022-10-30T12:11:32.2399451Z 12:11:32 BIOCONDA INFO (OUT) error[E0061]: this function takes 4 arguments but 3 arguments were supplied
2022-10-30T12:11:32.2401411Z 12:11:32 BIOCONDA INFO (OUT)    --> /opt/conda/conda-bld/pgr-tk_1667130798268/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/cargo-xwin-0.10.2/src/common.rs:238:22
2022-10-30T12:11:32.2402037Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.2402506Z 12:11:32 BIOCONDA INFO (OUT) 238 |         let pruned = xwin::prune_pkg_list(&pkg_manifest, arches, variants)?;
2022-10-30T12:11:32.2403808Z 12:11:32 BIOCONDA INFO (OUT)     |                      ^^^^^^^^^^^^^^^^^^^^--------------------------------- an argument of type `bool` is missing
2022-10-30T12:11:32.2404290Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.2404640Z 12:11:32 BIOCONDA INFO (OUT) note: function defined here
2022-10-30T12:11:32.2405510Z 12:11:32 BIOCONDA INFO (OUT)    --> /opt/conda/conda-bld/pgr-tk_1667130798268/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/xwin-0.2.9/src/lib.rs:263:8
2022-10-30T12:11:32.2406065Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.2406473Z 12:11:32 BIOCONDA INFO (OUT) 263 | pub fn prune_pkg_list(
2022-10-30T12:11:32.2406851Z 12:11:32 BIOCONDA INFO (OUT)     |        ^^^^^^^^^^^^^^
2022-10-30T12:11:32.2407221Z 12:11:32 BIOCONDA INFO (OUT) help: provide the argument
2022-10-30T12:11:32.2407682Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.2408177Z 12:11:32 BIOCONDA INFO (OUT) 238 |         let pruned = xwin::prune_pkg_list(&pkg_manifest, arches, variants, /* bool */)?;
2022-10-30T12:11:32.2408797Z 12:11:32 BIOCONDA INFO (OUT)     |                      ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
2022-10-30T12:11:32.2409214Z 12:11:32 BIOCONDA INFO (OUT) 
2022-10-30T12:11:32.3999345Z 12:11:32 BIOCONDA INFO (OUT) error[E0308]: mismatched types
2022-10-30T12:11:32.4000944Z 12:11:32 BIOCONDA INFO (OUT)    --> /opt/conda/conda-bld/pgr-tk_1667130798268/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/cargo-xwin-0.10.2/src/common.rs:280:47
2022-10-30T12:11:32.4001552Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.4002057Z 12:11:32 BIOCONDA INFO (OUT) 280 |                 ProgressBar::with_draw_target(0, draw_target.into()).with_prefix(prefix).with_style(
2022-10-30T12:11:32.4002914Z 12:11:32 BIOCONDA INFO (OUT)     |                 ----------------------------- ^ expected enum `Option`, found integer
2022-10-30T12:11:32.4003375Z 12:11:32 BIOCONDA INFO (OUT)     |                 |
2022-10-30T12:11:32.4003791Z 12:11:32 BIOCONDA INFO (OUT)     |                 arguments to this function are incorrect
2022-10-30T12:11:32.4004185Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.4004877Z 12:11:32 BIOCONDA INFO (OUT)     = note: expected enum `Option<u64>`
2022-10-30T12:11:32.4005278Z 12:11:32 BIOCONDA INFO (OUT)                found type `{integer}`
2022-10-30T12:11:32.4005705Z 12:11:32 BIOCONDA INFO (OUT) note: associated function defined here
2022-10-30T12:11:32.4006643Z 12:11:32 BIOCONDA INFO (OUT)    --> /opt/conda/conda-bld/pgr-tk_1667130798268/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/indicatif-0.17.1/src/progress_bar.rs:52:12
2022-10-30T12:11:32.4007219Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.4007923Z 12:11:32 BIOCONDA INFO (OUT) 52  |     pub fn with_draw_target(len: Option<u64>, draw_target: ProgressDrawTarget) -> ProgressBar {
2022-10-30T12:11:32.4008426Z 12:11:32 BIOCONDA INFO (OUT)     |            ^^^^^^^^^^^^^^^^
2022-10-30T12:11:32.4008820Z 12:11:32 BIOCONDA INFO (OUT) help: try wrapping the expression in `Some`
2022-10-30T12:11:32.4009206Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.4009733Z 12:11:32 BIOCONDA INFO (OUT) 280 |                 ProgressBar::with_draw_target(Some(0), draw_target.into()).with_prefix(prefix).with_style(
2022-10-30T12:11:32.4010273Z 12:11:32 BIOCONDA INFO (OUT)     |                                               +++++ +
2022-10-30T12:11:32.4010625Z 12:11:32 BIOCONDA INFO (OUT) 
2022-10-30T12:11:32.5079552Z 12:11:32 BIOCONDA INFO (OUT) error[E0308]: mismatched types
2022-10-30T12:11:32.5081136Z 12:11:32 BIOCONDA INFO (OUT)    --> /opt/conda/conda-bld/pgr-tk_1667130798268/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/cargo-xwin-0.10.2/src/common.rs:319:57
2022-10-30T12:11:32.5081718Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.5082195Z 12:11:32 BIOCONDA INFO (OUT) 319 |         let manifest_pb = ProgressBar::with_draw_target(0, dt.into())
2022-10-30T12:11:32.5083310Z 12:11:32 BIOCONDA INFO (OUT)     |                           ----------------------------- ^ expected enum `Option`, found integer
2022-10-30T12:11:32.5083763Z 12:11:32 BIOCONDA INFO (OUT)     |                           |
2022-10-30T12:11:32.5084188Z 12:11:32 BIOCONDA INFO (OUT)     |                           arguments to this function are incorrect
2022-10-30T12:11:32.5084585Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.5084944Z 12:11:32 BIOCONDA INFO (OUT)     = note: expected enum `Option<u64>`
2022-10-30T12:11:32.5085362Z 12:11:32 BIOCONDA INFO (OUT)                found type `{integer}`
2022-10-30T12:11:32.5085790Z 12:11:32 BIOCONDA INFO (OUT) note: associated function defined here
2022-10-30T12:11:32.5086695Z 12:11:32 BIOCONDA INFO (OUT)    --> /opt/conda/conda-bld/pgr-tk_1667130798268/_build_env/.cargo/registry/src/github.com-1ecc6299db9ec823/indicatif-0.17.1/src/progress_bar.rs:52:12
2022-10-30T12:11:32.5087288Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.5087992Z 12:11:32 BIOCONDA INFO (OUT) 52  |     pub fn with_draw_target(len: Option<u64>, draw_target: ProgressDrawTarget) -> ProgressBar {
2022-10-30T12:11:32.5088479Z 12:11:32 BIOCONDA INFO (OUT)     |            ^^^^^^^^^^^^^^^^
2022-10-30T12:11:32.5088883Z 12:11:32 BIOCONDA INFO (OUT) help: try wrapping the expression in `Some`
2022-10-30T12:11:32.5089269Z 12:11:32 BIOCONDA INFO (OUT)     |
2022-10-30T12:11:32.5089735Z 12:11:32 BIOCONDA INFO (OUT) 319 |         let manifest_pb = ProgressBar::with_draw_target(Some(0), dt.into())
2022-10-30T12:11:32.5090249Z 12:11:32 BIOCONDA INFO (OUT)     |                                                         +++++ +

I imagine that there was an API change in one of the dependencies.

Visualize minigraph output.

Hi,
Is it possible to visualize the pangenome graph of minigraph output using pgr-tk toolkit?

pgr-query returns no hits for known sequence

Hi,

I am attempting to use pgr-query to search the human pangenome draft. Known exact hits are not being found. For example:

pgr-query pangenome_draft1_v1.1 test1.fa test1_output

returns no hits and an empty fasta:

cat test1_output.hit
#out_seq_name   ctg_bgn ctg_end color   q_name  orientation     idx     q_idx   query_bgn       query_end       q_len  aln_anchor_count

The input sequence is definitely present:

cat test1.fa
>test1
CAGAATGGACCTTCTCCACCAGGAGAGGCTTCCAAGTGACTTGGACGGCATGCTCACTGAGCCCTTGGACTGTGACATGG

Querying a contig with agc returns the sequence:

agc getctg pangenome_draft1_v1.1.agc HG002#2#[email protected]_assembly_v2_genbank.fa | grep -n CAGAATGGACCTTCTCCACCAGGAGAGGCTTCCAAGTGACTTGGACGGCATGCTCACTGAGCCCTTGGACTGTGACATGG
3:CAGAATGGACCTTCTCCACCAGGAGAGGCTTCCAAGTGACTTGGACGGCATGCTCACTGAGCCCTTGGACTGTGACATGG

What might cause this? Is there a minimum query sequence length?

pgr-mdb error building index

I'm trying to build an index with the pgr-mdb utility, however I'm getting an error consistently even with the test data supplied in the repo. The error message is as follows:

thread 'main' panicked at 'called `Result::unwrap()` on an `Err` value: Error { kind: InvalidData, message: "stream did not contain valid UTF-8" }', pgr-bin/src/bin/pgr-mdb.rs:47:25
note: run with `RUST_BACKTRACE=1` environment variable to display a backtrace

I tried with multiple versions of AGC tool and also the pgr-mdb executable. I'm on Ubuntu server 22.04.

`pgr-mdb` is the only available command after conda install

Hi! Thanks for making PGR-TK. We're very interested in working with your toolkit! And it seems like a great resource for the community.

I tried to install PGR-TK using conda but was only able to run the pgr-mdb command. My understanding based on the README is that there are many other pgr commands.

Is there a reason your conda recipe copies only the pgr-mdb command into the user's bin, @cschin?

https://github.com/bioconda/bioconda-recipes/blob/15662093a41a5ca09a66355b179e4290e82c2026/recipes/pgr-tk/build.sh#L41

pgrtk-0.3.4-cp38-cp38-linux_x86_64.whl is not a supported wheel on this platform

Hello,

Can you please list which Linux distributions the wheels support? I have tried on both Ubuntu 20.04 and CentOS7, and both give the error of "not a supported wheel on this platform" when trying to pip install?

Thank you!

pgr-mdb - Segmentation Fault

Hi,

I'm getting a segmentation fault when running pgr-mdb. I'm using v0.4.1 downloaded from the releases page running within a docker image generated from: https://github.com/GeneDx/pgr-tk/blob/main/docker/Dockerfile.build_env-22.04

The following message is output prior to the core dump:

"Reading AGC file using the AGC library writting in C can cause segementation fault if wrong file type or corrupted AGC file is provided. If you see segenmentation fault, please make sure you have proper AGC files specifed as the input file.Segmentation fault (core dumped)"

I've also tried running pgr-mdb 0.3.6 via the conda installation and receive a seg fault without the above message.

The input AGC file was generated with AGC v3.0 against the human pangenome draft assemblies - very similar to https://github.com/GeneDx/pgr-tk-notebooks/blob/main/00-1-create_pgr_index.ipynb although I used hg38 as the reference and did not include hg19. I'm able to use AGC to query the generated AGC file without issue and am not aware of any corruption.

Is there a specific version of AGC required to be used with pgr-tk? Any suggestions on how to troubleshoot?

Command line:
docker run -v ${PWD}:${PWD} -i pgr-tk:0.1 sh -c "cd /mnt/efs/users/lmose/pangenome/pgr_tk/; target/release/pgr-mdb pgr_filelist.txt pangenome_draft1"

Filelist content:

cat pgr_filelist.txt
pangenome_draft1.agc

File listing:

ls -lh pangenome_draft1*
-rw-rw-r-- 1 ec2-user ec2-user 1.4G Jul  7 23:26 pangenome_draft1.agc

RUST error in Conda stable version

Hello,
Thanks for the excellent toolkit and congratulations for the publication. I have installed pgr-tk v0.3.6 as introduced in README.md, and tried to create pgr minimizer database with HPRC-yr1.agc with:
pgr-mdb HPRC-yr1.agc HPRC-yr1
but it raised an error as :
thread 'main' panicked at 'called 'Result::unwrap()' on an 'Err' value: Error { kind: InvalidData, message: "stream did not contain valid UTF-8" src/bin/pgr-mdb.rs:47:25 note: run with 'RUST_BACKTRACE=1' environment variable to display a backtrace
Same error when trying to pip install as #1
Thanks!
Xinjiang Tan

genedx / pgr-tk Goto Github PK

pgr-tk's People

Contributors

Stargazers

Watchers

Forkers

pgr-tk's Issues

Install Error Message

The Code for plotting Figure 3

Compilation error

Visualize minigraph output.

pgr-query returns no hits for known sequence

pgr-mdb error building index

`pgr-mdb` is the only available command after conda install

pgrtk-0.3.4-cp38-cp38-linux_x86_64.whl is not a supported wheel on this platform

pgr-mdb - Segmentation Fault

RUST error in Conda stable version

Recommend Projects

React

Vue.js

Typescript

TensorFlow

Django

Laravel

D3

Recommend Topics

javascript

web

server

Machine learning

Visualization

Game

Recommend Org

Facebook

Microsoft

Google

Alibaba

D3

Tencent