Coder Social home page Coder Social logo

smith-watermanalgorithm's Introduction

Smith-WatermanAlgorithm

algorithm for finding local sequence alignments

Example use

from command line:

navigate to the src folder.

pass the FASTA files as arguments.

python align.py seq1 seq2 

Example output

Results are saved to the results file.

GCTACGACTCAGCTCAGTGAGCTGCATGCCTTCAAGCTTCGGGTGGAT-CCTGCCAACTT
 |  | | |      ||    |    | ||  | | |      | |     |  |     
-CGCC-AATTTCA--AGAT-TC-T-GT-CCCAC-AACA--TCCTCGTGG--T-TCTGG-C

TAAGATC-CT--GGC-CCACAACATGATGTTGGTAATCGCCATGTACTTCCCTGGCGAGT
 |   |   |    |    |   |         |   |  |   |        |||    
CACTTTGT-TCCC-CG---CCG-AC--------TTCACT-C--CTG---A---GGCTCA-

TCACTCCAGAGGTCCACCTCTCAGTTG-ACAAGTTCCTTGCGTGCCTGGCTTTGGCTCTG
|   | |        |     ||  |   |    | | |  |   |||||| ||||  ||
TG-TTGC-----A--ATGGA-CAAGT-TCC----T-C-TCAGCT-CTGGCTCTGGCCATG

TCTGAGAAGTACCGCTAAA
|||||||||||| | ||||
TCTGAGAAGTACAGATAAA

Score: 142

smith-watermanalgorithm's People

Contributors

clc89 avatar calebcoulter avatar arc63 avatar

Watchers

Alen Zhao avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.