oamodelmicrorna's Introduction

ACL model of osteoarthritis mRNA and miRNA analysis

Overview

The following R notebooks can be used to generate the bioinformatics figures and tables shown in the paper:

01_ACLmRNA.qmd - DESeq2 analysis of the ACL rupture model mRNA-seq
02_ACLmiRNA.qmd - DESeq2 analysis of the ACL rupture model smallRNA-seq
03_mir199DiffExp.qmd - RNA-seq Differential expression, gene ontology and target analysis of mir199 inhibited HACs
04_DMMDiffExp.qmd - DESeq2 analysis of the DMM OA model mRNA-seq

Running the analysis

Reproducibly with singularity

After cloning/downloading this repository.

Install Singularity

Download and run the singularity container

 singularity run https://pgb.liv.ac.uk/~jsoul/OAModelmicroRNA/analysis.img

Build the singularity container:

 sudo singularity build runAnalysis.img Singularity

Run the analysis and render tables and figures with a single command:
```
 ./runAnalysis.img
```

Alternatively using RScript

Install the needed R packages
```
 RScript install/install.R
```
Run the analysis and render the html notebooks
```
 RScript runAnalysis.R
```

Raw data processing

For the smallRNA-seq data the nextflow core smrnaseq v1.1.0 was run using:

nextflow run nf-core/smrnaseq -r 1.1.0 --input "fastqFiles/*.fastq.gz" --genome GRCm38 --protocol 'custom' --three_prime_adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --mirtrace_protocol illumina --max_cpus 6 -profile singularity

Skeletalvis pipeline was used to process the RNA-seq data (github.com/soulj/SkeletalVis-Pipeline)

Recommend Projects