Coder Social home page Coder Social logo

nihakuto / seqparse Goto Github PK

View Code? Open in Web Editor NEW

This project forked from lattice-automation/seqparse

0.0 0.0 0.0 5.45 MB

Parse sequence files (GenBank, FASTA, SnapGene, SBOL) and accession IDs (NCBI, iGEM) to a common format

License: MIT License

Shell 0.55% JavaScript 3.86% TypeScript 78.55% Gnuplot 17.03%

seqparse's Introduction

seqparse

npm version

Parse sequence files (GenBank, FASTA, JBEI, SnapGene, SBOL) or accession IDs (NCBI, iGEM) to a simple, common format:

interface Seq {
  name: string;
  type: "dna" | "rna" | "aa" | "unknown";
  seq: string;
  annotations: Annotation[];
}

interface Annotation {
  name: string;
  start: number;
  end: number;
  direction?: number;
  color?: string;
  type?: string;
}

Installation

npm i seqparse

To install the CLI globally:

npm i -g seqparse

Examples

Library

import seqparse from "seqparse";

const { name, type, seq, annotations } = await seqparse(file);

CLI

Example outputs are truncated for clarity.

# parse files
$ seqparse pBbE0c-RFP.gb
{
  "name": "pBbE0c-RFP",
  "type": "dna",
  "seq": "cagctagctcagtcctaggtactgtgctagctacta...",
  "annotations": [
    {
      "name": "colE1 origin",
      "start": 1234,
      "end": 1917,
      "direction": -1,
      "type": "rep_origin"
    },
...

# parse files from stdin
$ cat pBbE0c-RFP.fasta | seqparse
{
  "name": "pBbE0c-RFP.1",
  "type": "dna",
  "seq": "cagctagctcagtcctagg...",
  "annotations": []
}

# parse files then use jq to get seqs alone
$ seqparse j5.SBOL.xml | jq -r '.seq'
ggcagcaaggtctacggcaaggaacagtttttgcggatgcgccagagcatgttccccgatcgc

# fetch and parse remote sequence files from NCBI
$ seqparse NC_011521
{
  "name": "NC_011521",
  "type": "dna",
  "seq": "cccatcttaagacttcacaagactt...",
  "annotations": [
    {
      "name": "HS566_RS00005",
      "start": 6,
      "end": 285,
      "direction": -1,
      "type": "gene"
    },
...

seqparse's People

Contributors

nihakuto avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.