Coder Social home page Coder Social logo

intsiteretriever's People

Contributors

anatolydryga avatar cnobles avatar esherm avatar helixscript avatar yhwu avatar

Watchers

avatar avatar avatar avatar avatar avatar avatar avatar avatar

Forkers

heath1210

intsiteretriever's Issues

package install error 

> devtools::install_github("BushmanLab/intSiteRetriever")
Downloading github repo BushmanLab/intSiteRetriever@master
Installing intSiteRetriever
'/home/yinghua/opt/lib/R/bin/R' --no-site-file --no-environ --no-save  \
  --no-restore CMD INSTALL  \
  '/tmp/RtmpWsRlgL/devtools79805e41781b/BushmanLab-intSiteRetriever-8403f72'  \
  --library='/home/yinghua/R' --install-tests

* installing *source* package ‘intSiteRetriever’ ...
ERROR: a 'NAMESPACE' file is required
* removing ‘/home/yinghua/R/intSiteRetriever’
Error: Command failed (1)

get_random_positions returns the same results

is this expected?

> get_random_positions(3, reference, 'm')
  siteID   chr strand  position
1      3 chr12      - 115298367
2      3 chr11      +  97835402
3      3  chr4      -  25417571
> get_random_positions(3, reference, 'm')
  siteID   chr strand  position
1      3 chr12      - 115298367
2      3 chr11      +  97835402
3      3  chr4      -  25417571
> get_random_positions(3, reference, 'm')
  siteID   chr strand  position
1      3 chr12      - 115298367
2      3 chr11      +  97835402
3      3  chr4      -  25417571

list 

$sample_sex
              alias                                  linkerSequence        bcSeq gender  primer  ltrBit                       largeLTRFrag        vectorSeq
1          clone1-1 CGCAGACATCCCGTCCCATNNNNNNNNNNNNCTCCGCTTAAGGGACT AATCCGTACAGC      f GAAAATC TCTAGCA TGCTAGAGATTTTCCACACTGACTAAAAGGGTCT p746vector.fasta

Only alias and gender are necessary, sample_sex to sample_info?

aggregate on 0 rows error

read_sites_sample_GTSP <- get_read_site_totals(sampleName_GTSP, dbConn)
Joining by: "sampleID"
Joining by: "siteID"
Error in .local(x, ...) : no rows to aggregate

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.