Coder Social home page Coder Social logo

azalea / pyfaidx Goto Github PK

View Code? Open in Web Editor NEW

This project forked from mdshw5/pyfaidx

0.0 2.0 0.0 401 KB

pyfaidx: efficient pythonic random access to fasta subsequences

Home Page: https://pypi.python.org/pypi/pyfaidx

License: MIT License

Python 100.00%

pyfaidx's Introduction

Travis PyPI

Please cite Shirley, Matthew (2014): pyfaidx: efficient pythonic random access to fasta subsequences. figshare. DOI:10.6084/m9.figshare.972933.

Description

Samtools provides a function "faidx" (FAsta InDeX), which creates a small flat index file ".fai" allowing for fast random access to any subsequence in the indexed fasta, while loading a minimal amount of the file in to memory.

Pyfaidx provides an interface for creating and using this index for fast random access of DNA subsequences from huge fasta files in a "pythonic" manner. Indexing speed is comparable to samtools, and in some cases sequence retrieval is much faster (benchmark). For example:

>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> genes
Fasta("tests/data/genes.fasta")

Acts like a dictionary.

>>> genes.keys() ['NR_104215.1',
'KF435150.1', 'NM_001282548.1', 'NM_001282549.1', 'XM_005249644.1',
'NM_001282543.1', 'NR_104216.1', 'XM_005265508.1', 'XR_241079.1',
'AB821309.1', 'XM_005249645.1', 'XR_241081.1', 'XM_005249643.1',
'XM_005249642.1', 'NM_001282545.1', 'NR_104212.1', 'XR_241080.1',
'XM_005265507.1', 'KF435149.1', 'NM_000465.3']

>>> genes['NM_001282543.1'][200:230]
>NM_001282543.1:201-230
CTCGTTCCGCGCCCGCCATGGAACCGGATG

>>> genes['NM_001282543.1'][200:230].seq
'CTCGTTCCGCGCCCGCCATGGAACCGGATG'

>>> genes['NM_001282543.1'][200:230].name
'NM_001282543.1:201-230'

>>> genes['NM_001282543.1'][200:230].start
201

>>> genes['NM_001282543.1'][200:230].end
230

>>> len(genes['NM_001282543.1'])
5466

Slices just like a string:

>>> genes['NM_001282543.1'][200:230][:10]
>NM_001282543.1:201-210
CTCGTTCCGC

>>> genes['NM_001282543.1'][200:230][::-1]
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

>>> genes['NM_001282543.1'][200:230][::3]
>NM_001282543.1:201-230
CGCCCCTACA

>>> genes['NM_001282543.1'][:]
>NM_001282543.1:1-5466
CCCCGCCCCT........
  • Start and end coordinates are 0-based, just like Python.

Complements and reverse complements just like DNA

>>> genes['NM_001282543.1'][200:230].complement
>NM_001282543.1 (complement):201-230
GAGCAAGGCGCGGGCGGTACCTTGGCCTAC

>>> genes['NM_001282543.1'][200:230].reverse
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

>>> -genes['NM_001282543.1'][200:230]
>NM_001282543.1 (complement):230-201
CATCCGGTTCCATGGCGGGCGCGGAACGAG

Custom key functions provide cleaner access:

>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', key_function = lambda x: x.split('.')[0])
>>> genes.keys()
dict_keys(['NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])
>>> genes['NR_104212'][:10]
>NR_104212:1-10
CCCCGCCCCT

It also provides a command-line script:

cli script: faidx

$ faidx tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
>NM_001282543.1
CTCGTTCCGC
>NM_001282543.1
GTAATTGTGTAAGTGACTGCA

$ faidx --complement tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1
GAGCAAGGCG

$ faidx --reverse tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1
CGCCTTGCTC

$ faidx tests/data/genes.fasta NM_001282543.1
>NM_001282543.1
CCCCGCCCCT........

$ faidx tests/data/genes.fasta --list regions.txt
...

Similar syntax as samtools faidx

A lower-level Faidx class is also available:

>>> from pyfaidx import Faidx
>>> fa = Faidx('T7.fa')
>>> fa.build('T7.fa', 'T7.fa.fai')
>>> fa.index
{'EM_PHG:V01146': {'lenc': 60, 'lenb': 61, 'rlen': 39937, 'offset': 40571}, 'EM_PHG:GU071091': {'lenc': 60, 'lenb': 61, 'rlen': 39778, 'offset': 74}}

>>> fa.fetch('EM_PHG:V01146', 1, 10)
EM_PHG:V01146
TCTCACAGTG

>>> fa.fetch('EM_PHG:V01146', 100, 120)
>EM_PHG:V01146
GGTTGGGGATGACCCTTGGGT
  • If the FASTA file is not indexed, when Faidx is initialized the build method will automatically run, producing "filename.fa.fai" where "filename.fa" is the original FASTA file.
  • Start and end coordinates are 1-based.

Installation

This package is tested under Python 3.3, 3.2, 2.7, 2.6, and pypy.

pip install pyfaidx

or

python setup.py install

CLI Usage

"samtools faidx" compatible FASTA indexing in pure python.

usage: faidx [-h] [-l LIST] [-n] [--complement] [--reverse]
             fasta [regions [regions ...]]

Fetch sequence from faidx-indexed FASTA

positional arguments:
  fasta                 FASTA file
  regions               space separated regions of sequence to fetch e.g.
                        chr1:1-1000

optional arguments:
  -h, --help            show this help message and exit
  -l LIST, --list LIST  list of regions, one per line
  -n, --name            print sequence names. default: True
  --complement          comlement the sequence. default: False
  --reverse             reverse the sequence. default: False

Changes

New in version 0.1.9:

  • line wrapping of faidx is set based on the wrapping of the indexed fasta file
  • added --reverse and --complement arguments to faidx

New in version 0.1.8:

  • key_function keyword argument to Fasta allows lookup based on function output

Acknowledgements

This project is freely licensed by the author, Matthew Shirley, and was completed under the mentorship and financial support of Drs. Sarah Wheelan and Vasan Yegnasubramanian at the Sidney Kimmel Comprehensive Cancer Center in the Department of Oncology.

pyfaidx's People

Contributors

mdshw5 avatar azalea avatar brentp avatar

Watchers

 avatar James Cloos avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.