alphaneer / hts-python

pythonic wrapper for htslib

hts-python

pythonic wrapper for htslib C-API using python cffi.

There is enough functionality for this to be useful, but it still needs a lot of work.

A taste

>>> import os.path as op

>>> from hts import Bam
>>> bam = Bam("hts/test/small.bam") #bam stolen from pybedtools [thanks]
>>> list(bam.header.seqs)
['chr2L', 'chr2R', 'chr3L', 'chr3R', 'chr4', 'chrX']

# region query creates index if needed:
>>> a = next(bam('chr2L:9000-11000'))
>>> a
Alignment('HWUSI-NAME:2:69:512:1017#0')
>>> a.target, a.pos, a.strand
('chr2L', 9329, '-')
>>> a.qlen, a.rlen
(36, 36)
>>> a.strand
'-'
>>> a.seq
'TACAAATCTTACGTAAACACTCCAAGCATGAATTCG'
>>> a.qual[:10]
[56, 63, 53, 62, 64, 62, 51, 44, 58, 59]

>>> a.flag, a.flag_str
(16, 'REVERSE')

>>> a.cigar
Cigar('36M')

>>> str(a)[:40]
'HWUSI-NAME:2:69:512:1017#0\t16\tchr2L\t9330'

There are also wrappers for:

• Fai for fasta querying fasta files.
• Tbx for tabix files (indexed bed/gff/sam, etc.).
• fisher for fisher's exact test.

Installation

1. Install [htslib](https://github.com/samtools/htslib.git htslib) using make install
2. pip/easy_install python cffi.
3. run python setup.py install (--user) from this directory.

Development

This is a work in progress that relies on the hts library. All of the wrapped functions are included in hts/hts_concat.h and then available from python as, e.g. htslib.sam_read1

When C-functions not provided by the api are needed, they are added to hts_extra.c/.h.

One can run the tests with: python -c "import hts; hts.doctests()"

There is enough functionality for this to be quite useful but most of it is limited to getters, not setters, to, for example update an INFO field or modify the bam quality scores.

Things to work on:

1. Make properties settable in hts.bam. Currently, they are read-only properties. At very least, it will be useful to have setters for seq, base_q, qname, tname, pos, strand, flag.

2. Wrap B/VCF stuff? (in progress)

Why

Why use this when pysam exists? It's an experiment with python cffi and to provide a pythonic access to htslib.