Coder Social home page Coder Social logo

dssp's Introduction

README

DSSP is a system for splice site prediction using deep neural networks, as described in Human Splice-Site Prediction with Deep Neural Networks. Naito T. J Comput Biol. 2018;25(8):954–61.

Required

  • DSSP is implemented in Python (3.5.2).
  • Keras must be installed to run our program. We recommend Keras 2.0.5 since different versions may cause unexpected errors. Several modules may be required for using Keras. Please read the official documentations.

Usage

  • Download all files into your favorite directory.
  • Select a program file according to the type of splice site (donor site: “DS_DSSP.py,” acceptor site: “AS_DSSP.py”).
  • The required input is a 140-mer base sequence with the consensus sequence (i.e., ‘‘GT’’ and ‘‘AG’’ for the donor and acceptor sites, respectively) in the middle.
  • DSSP can take a base sequence string or FASTA file (see Examples).
  • It returns the probability that the input sequence is a splice site.
    Options:
    • -I, INPUT : 140-mer base sequece string, or FASTA file.
    • -O, OUTPUT: path to the output file.

Examples

Donor site

An input for donor site should be a 140-mer string with the GT at positions 71 and 72.

$ python DS_DSSP.py -I CTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCAGCCAGTGCCACCATGCGCGCTCAGTGTAAGTATCATTCCCTCTCACTG
TCCTGGAGAGGACGAGAATTCCACCTGGGGTGCTGGGGGTCACTGGG

Result

Donor site probability: 0.9999337196350098

Alternatively, DSSP can receive a FASTA file.
You can specify an output filename optionally. If you do not specify an output filename, the results are saved as "{input filename}_result.txt" in the same directory as the input file.

$ python DS_DSSP.py -I input.fasta -O output.txt 

Acceptor site

An input for acceptor site should be a 140-mer string with the AG at positions 69 and 70.

$ python AS_DSSP.py -I GGCCAGGGGCATAGAGCTGGCCAAGGAGCCATGGCTCACTAACGTGTTGTATGGGGCTCCTTCCCTTCAGGTCCAGGCTCCTGCGTGAAGTGA
TGCTCCTCTTTGCCTTACTCCTAGCCATGGAGCTCCCATTGGTGGCA

Result

Acceptor site probability:: 0.9931520223617554

You can input a FASTA file, and specify an output filename in the same way as the DS_DSSP example.

License

  • The souce code can be modified without notice.
  • DSSP is freely available for non-commercial use. If you are planning on using DSSP in a commercial application, please contact us.
  • No claim of suitability, guarantee, or any warranty whatever happens.

dssp's People

Contributors

dssp-github avatar tntntntntn avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.