Comments (3)
@jltsiren I think this is a problem with the minimizers. There were a bunch of errors like this
MinimizerIndex::find_offset(): Cannot find the offset for key 66075703255364729
from vg.
It sounds like the minimizer index is corrupted. You could try rebuilding it with:
vg minimizer -p -d graph.dist -o graph.min graph.gbz
Also, are what does the vg giraffe
command output during initialization? Are there any errors/warnings?
from vg.
Hello again,
It worked perfectly after rebuilding the minimizer index! Now I am getting this GAF output:
D00562:114:C94WFANXX:7:1111:1229:2161 125 0 125 + <48413770<48413771<48413772<48413773<48413775<48413776<48413778<48413779<48413780<48413781<48413782 173 7 131 124 125 60 AS:i:130 bq:Z:CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGDFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG cs:Z::76*AG:48 dv:f:0.008 fn:Z:D00562:114:C94WFANXX:7:1111:1229:2161 pd:b:1
I used to get these outputs while running vg giraffe (which I haven't gotten right now):
MinimizerIndex::find_offset(): Cannot find the offset for key 237432784254556
MinimizerIndex::find_offset(): Cannot find the offset for key 3709887253977
MinimizerIndex::find_offset(): Cannot find the offset for key 229929871826950668
MinimizerIndex::find_offset(): Cannot find the offset for key 68746704681186812
T19: All minimizers:
T19: 00000000000000000000000000000000000000000000000000000000000000000000000000000000
000000000000000000001111111111111111111111111
T19: 00000000001111111111222222222233333333334444444444555555555566666666667777777777
888888888899999999990000000000111111111122222
T19: 01234567890123456789012345678901234567890123456789012345678901234567890123456789
012345678901234567890123456789012345678901234
T19: CGATTCGATGGGGTTTGAAAGACATCACTTCACTGCTACCTGTTTTTAACCNTGATGACCAACTTATAGGCGAGATTATT
CCGTAAAGGATTTTTTTTCATTATAATTGAATATTTAGCTGCAAT
T19: -------ATGGGGTTTGAAAGACATCACTTCACTGC---------- (#0, 0 hits)
T19: --------AAACAGGTAGCAGTGAAGTGATGTCTTTC---------- (#2, 0 hits)
T19: ---TTAAAAACAGGTAGCAGTGAAGTGATGTC---------- (#3, 0 hits)
Thank you very much!!
from vg.
Related Issues (20)
- Bump necessary magic numbers for long-read index types HOT 1
- vg autoindex --workflow mpmap HOT 1
- GAF nodes do not correspond to VCF nodes HOT 3
- Fastq analysis in euka HOT 2
- Protobuf errors mapping HOT 4
- vg augment crashes in combination with giraffe .gam outputs HOT 5
- when i do the code :vg stats -a var1.gam > var1.stats ,show me a bug HOT 2
- vg surject and pack fail on GraphAligner produced .gam HOT 4
- About the usage of vg deconstruct HOT 5
- Right method to annotate genes on pangenome graph HOT 1
- vg call report missing allele HOT 2
- vg call error HOT 2
- How do different methods affect precision? HOT 4
- Giraffe alignment is very slow and produces warning[vg::Watchdog] messages unless rescue is disabled HOT 12
- Giraffe needs to better deal with systems where multiple processes opening the distance index causes slowdowns
- Any option like BWA MEM '-C'?
- vg convert failes while converting gbz to xg with signal 6 error HOT 2
- Release vg v1.60.0
- `vg convert --vg-algorithm` loses start coordinates of paths in its W lines HOT 1
- The Amazing Uninjectable SAM
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from vg.