IndexError: sequence length is not enough in R1 read about celescope

[zhouyiqi91]

It looks like the R1 fastq file is truncated, which causes an error when automatically detecting chemistry. Chemistry can be specified explicitly to skip automatic detection of chemistry:

multi_rna \
 --chemistry scopeV3.0.1 \
..

[calcaidecabello]

Hi, I tried yesterday to specifically define chemistry as that and I obtained an error that was a bit different but it was saying the same about R1 reads.

…

----- Original Message ----- From: Tony Zhou ***@***.***> To: singleron-RD/CeleScope ***@***.***> Cc: calcaidecabello ***@***.***>, Author ***@***.***> Sent: Wed, 15 May 2024 06:11:03 +0200 (CEST) Subject: Re: [singleron-RD/CeleScope] IndexError: sequence length is not enough in R1 read (Issue #285) It looks like the R1 fastq file is truncated, which causes an error when automatically detecting chemistry. Chemistry can be specified explicitly to skip automatic detection of chemistry: ``` multi_rna \ --chemistry scopeV3.0.1 \ .. ```

-- Reply to this email directly or view it on GitHub: #285 (comment) You are receiving this because you authored the thread. Message ID: ***@***.***>

[calcaidecabello]

Hi, I repeated to copy the error, and this is what I obtained: 2024-05-15 09:15:12,797 - celescope.tools.sample.sample - INFO - start... CeleScope version: 2.0.7 Args: Namespace(subparser_assay='rna', outdir='.//Bnsortednuclei1/00.sample', sample='Bnsortednuclei1', thread='16', debug=False, fq1='/netscratch/dep_coupland/grp_turck/People/Cristina/GC_6460/00_rawdata/Bnsortednuclei_R1.fastq.gz', chemistry='scopeV3.0.1', wells=384, func=<function sample at 0x7efc807f6820>) 2024-05-15 09:15:12,896 - celescope.tools.sample.run - INFO - start... Sample ID: Bnsortednuclei1 Assay: rna Chemistry: scopeV3.0.1 (kit V2) Software Version: 2.0.7 2024-05-15 09:15:12,897 - celescope.tools.sample.run - INFO - done. time used: 0:00:00.000273 2024-05-15 09:15:12,898 - celescope.tools.step._clean_up - INFO - start... 2024-05-15 09:15:12,929 - celescope.tools.step._render_html - INFO - start... 2024-05-15 09:15:14,182 - celescope.tools.step._render_html - INFO - done. time used: 0:00:01.252553 2024-05-15 09:15:14,182 - celescope.tools.step._clean_up - INFO - done. time used: 0:00:01.284344 2024-05-15 09:15:14,182 - celescope.tools.sample.sample - INFO - done. time used: 0:00:01.384928 CeleScope version: 2.0.7 Args: Namespace(subparser_assay='rna', chemistry='scopeV3.0.1', pattern=None, whitelist=None, adapter_3p='AAAAAAAAAAAA', genomeDir='/netscratch/dep_coupland/grp_turck/People/Cristina/GC_6460/ZS11/', outFilterMatchNmin='50', soloCellFilter='EmptyDrops_CR 3000 0.99 10 45000 90000 500 0.01 20000 0.001 10000', starMem='32', STAR_param='', SAM_attributes='', soloFeatures='Gene GeneFull_Ex50pAS', fq1='/netscratch/dep_coupland/grp_turck/People/Cristina/GC_6460/00_rawdata/Bnsortednuclei_R1.fastq.gz', fq2='/netscratch/dep_coupland/grp_turck/People/Cristina/GC_6460/00_rawdata/Bnsortednuclei_R2.fastq.gz', outdir='.//Bnsortednuclei1/01.starsolo', sample='Bnsortednuclei1', thread='16', debug=False, func=<function starsolo at 0x7fd387e0dee0>) STAR \ --genomeDir /netscratch/dep_coupland/grp_turck/People/Cristina/GC_6460/ZS11/ \ --readFilesIn /netscratch/dep_coupland/grp_turck/People/Cristina/GC_6460/00_rawdata/Bnsortednuclei_R2.fastq.gz /netscratch/dep_coupland/grp_turck/People/Cristina/GC_6460/00_rawdata/Bnsortednuclei_R1.fastq.gz \ --readFilesCommand zcat \ --soloCBwhitelist /netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/data/chemistry/scopeV3.0.1/bclist1 /netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/data/chemistry/scopeV3.0.1/bclist2 /netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/data/chemistry/scopeV3.0.1/bclist3 \ --soloCellFilter EmptyDrops_CR 3000 0.99 10 45000 90000 500 0.01 20000 0.001 10000 \ --outFileNamePrefix .//Bnsortednuclei1/01.starsolo/Bnsortednuclei1_ \ --runThreadN 16 \ --clip3pAdapterSeq AAAAAAAAAAAA \ --outFilterMatchNmin 50 \ --soloFeatures Gene GeneFull_Ex50pAS \ --outSAMattributes NH HI nM AS CR UR CB UB GX GN \ --soloType CB_UMI_Complex \ --soloCBposition 0_0_0_8 0_25_0_33 0_50_0_58 \ --soloUMIposition 0_60_0_71 --soloUMIlen 12 \ --soloCBmatchWLtype 1MM \ --outSAMtype BAM SortedByCoordinate \ --soloCellReadStats Standard \ --soloBarcodeReadLength 0 \ chmod: cannot access './/Bnsortednuclei1/01.starsolo/Bnsortednuclei1_Solo.out/': No such file or directory chmod -R 755 .//Bnsortednuclei1/01.starsolo/Bnsortednuclei1_Solo.out/Traceback (most recent call last): File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/bin/celescope", line 8, in <module> sys.exit(main()) File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/celescope.py", line 54, in main args.func(args) File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/tools/starsolo.py", line 186, in starsolo q30_cb, q30_umi, chemistry = runner.run() File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/tools/starsolo.py", line 177, in run self.run_starsolo() File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/tools/starsolo.py", line 136, in run_starsolo subprocess.check_call(cmd, shell=True) File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/subprocess.py", line 373, in check_call raise CalledProcessError(retcode, cmd) subprocess.CalledProcessError: Command 'chmod -R 755 .//Bnsortednuclei1/01.starsolo/Bnsortednuclei1_Solo.out/' returned non-zero exit status 1. 2024-05-15 09:15:24,667 - celescope.rna.analysis.analysis - INFO - start... CeleScope version: 2.0.7 Args: Namespace(subparser_assay='rna', genomeDir='/netscratch/dep_coupland/grp_turck/People/Cristina/GC_6460/ZS11/', matrix_file='.//Bnsortednuclei1/outs/filtered', outdir='.//Bnsortednuclei1/02.analysis', sample='Bnsortednuclei1', thread='16', debug=False, func=<function analysis at 0x7f0d5bb184c0>) CeleScope version: 2.0.7 Args: Namespace(subparser_assay='rna', genomeDir='/netscratch/dep_coupland/grp_turck/People/Cristina/GC_6460/ZS11/', matrix_file='.//Bnsortednuclei1/outs/filtered', outdir='.//Bnsortednuclei1/02.analysis', sample='Bnsortednuclei1', thread='16', debug=False, func=<function analysis at 0x7f0d5bb184c0>) Traceback (most recent call last): File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/bin/celescope", line 8, in <module> sys.exit(main()) File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/celescope.py", line 54, in main args.func(args) File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/tools/utils.py", line 45, in wrapper result = func(*args, **kwargs) File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/rna/analysis.py", line 64, in analysis runner.run() File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/rna/analysis.py", line 38, in run with analysis_wrapper.Scanpy_wrapper(self.args, display_title=self.display_title) as scanpy_wrapper: File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/celescope/tools/analysis_wrapper.py", line 59, in __init__ self.adata = sc.read_10x_mtx( File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/scanpy/readwrite.py", line 490, in read_10x_mtx adata = read( File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/scanpy/readwrite.py", line 554, in _read_v3_10x_mtx adata = read( File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/scanpy/readwrite.py", line 112, in read return _read( File "/netscratch/dep_coupland/grp_turck/lib/micromamba/envs/Cris_singleron_snseq/lib/python3.9/site-packages/scanpy/readwrite.py", line 737, in _read raise FileNotFoundError(f'Did not find file {filename}.') FileNotFoundError: Did not find file Bnsortednuclei1/outs/filtered/matrix.mtx.gz. Best, Cristina. From: "Tony Zhou" ***@***.***> To: "singleron-RD/CeleScope" ***@***.***> Cc: "Cristina Alcaide" ***@***.***>, "Author" ***@***.***> Sent: Wednesday, 15 May, 2024 06:11:03 Subject: Re: [singleron-RD/CeleScope] IndexError: sequence length is not enough in R1 read (Issue #285) It looks like the R1 fastq file is truncated, which causes an error when automatically detecting chemistry. Chemistry can be specified explicitly to skip automatic detection of chemistry: multi_rna \ --chemistry scopeV3.0.1 \ .. — Reply to this email directly, [ #285 (comment) | view it on GitHub ] , or [ https://github.com/notifications/unsubscribe-auth/BIPNUQUQGXPNQ2KR2IWSAX3ZCLN5PAVCNFSM6AAAAABHWDQIM6VHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMZDCMJRGU2DINRSGQ | unsubscribe ] . You are receiving this because you authored the thread. Message ID: <singleron-RD/CeleScope/issues/285/2111544624 @ github . com>

[zhouyiqi91]

Would you please check the length read of R1 fastq reads? Are their lengths 61bp like the read in the error report?
scopeV3.0.1 requires a minimum R1 read length of 72bp

It seems that the main error is "IndexError: sequence length is not enough in R1 read: TGCCTGATCCGAACATGTAGGTCTCTGTCGGTGTGACTACGTATTAGCATGTGTCTGAACT"

[calcaidecabello]

Hi, I have been talking with Khalil from technical support, we have checked the FASTQC files and the reads are 150pb in length. We haven't been able to identify the error. Best, Cristina. From: "Tony Zhou" ***@***.***> To: "singleron-RD" ***@***.***> Cc: "Cristina Alcaide" ***@***.***>, "Author" ***@***.***> Sent: Wednesday, 15 May, 2024 09:59:56 Subject: Re: [singleron-RD/CeleScope] IndexError: sequence length is not enough in R1 read (Issue #285) Would you please check the length read of R1 fastq reads? Are their lengths 61bp like the read in the error report? scopeV3.0.1 requires a minimum R1 read length of 72bp It seems that the main error is "IndexError: sequence length is not enough in R1 read: TGCCTGATCCGAACATGTAGGTCTCTGTCGGTGTGACTACGTATTAGCATGTGTCTGAACT" — Reply to this email directly, [ #285 (comment) | view it on GitHub ] , or [ https://github.com/notifications/unsubscribe-auth/BIPNUQUNAWMJI32SULMKXLTZCMIXZAVCNFSM6AAAAABHWDQIM6VHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMZDCMJRHAZTGMBWGM | unsubscribe ] . You are receiving this because you authored the thread. Message ID: <singleron-RD/CeleScope/issues/285/2111833063 @ github . com>

[zhouyiqi91]

It seems that at least one R1 read is 61bp in length, which does not meet the minimum requirement of 72bp.
You can use grep to find this read.
zcat {R1 fastq.gz} | grep -B 1 -A 2 TGCCTGATCCGAACATGTAGGTCTCTGTCGGTGTGACTACGTATTAGCATGTGTCTGAACT

In theory, the length of each read of the raw data should be the same. Why does this short read appear? Maybe

• The fastq file is truncated.
• The sequencing software has done some special processing.

While it may be important to find the reason for the short read length, here are some ways to bypass this error:

• Use the new nextflow-based pipeline: https://github.com/singleron-RD/scrna ; no R1 read minimum length check is performed.
• Use the v2.0.7_no_R1_len_check branch where R1 read minimum length check is disabled.

git clone -b v2.0.7_no_R1_len_check --single-branch https://github.com/singleron-RD/CeleScope.git
conda activate celescope
pip uninstall celescope
cd CeleScope
pip install .

[tuqiang2014]

您好，请问当测序R1 pattern 是这样的 C9L16C9L16C9U12=71bp，该如何正确运行celescope呢？

回复： 参考#276 这里。设置 以下参数 ：--chemistry customized --pattern --whitelist