Comments (4)
It is difficult to see in the text I pasted above, but view it fixed-width in a txt editor. It seems like the last piece of the quality string is the read!
from htstream.
Copy paste error
finalQual += seq2.substr(maxLoop, r2.getLength() - maxLoop);
Should have been . . .
finalQual += qual2.substr(maxLoop, r2.getLength() - maxLoop);
from htstream.
ID text still blank:
@id
ATGCTCACTACCACTCTCTCCGTACTGGAATATTCATCTACTCCCATTTTGCTGACTCTTATACCTCTCAGCGACATTTCCGTGCTTGGGGTCATATCAGGCAATATTCCGATCATTCCCATTACACTGTCAATGGGTTCAATCCCCCAGTTCTGGAAAAGCACTTTTGCATCCTTTTGGAAATGCCTCAAGAGTTGGTG
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@id
TTTCCCCAACGATTGCTCCCTCCTCAGTGAAAGCCCTTAGTAGTATCAAAGTTTCTAATCGATTAAAGATCACACTGAAGTTCGCTTTCAGTATAATGTTCTTTTCCATGATCGCCTGGTCCATTCGCACATAAAGAGGGCCTATTATCTTTTGCCTAGGCATGAGCATGAACCAGTCTCGTGACATTTCCTCGAGGGTCATGTCAGCTATGT
+
"IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
from htstream.
It is a feature to reduce memory. ;) Just kidding, Fixed in N-Remover, will close once merged into master.
from htstream.
Related Issues (20)
- Feature downgrade actually, remove -a option from SuperD
- -m (minLength) option removed from hts_QWindowTrim, but does not exist in hts_CutTrim HOT 3
- Flag use HOT 1
- Is "percentage-hits" calculated properly for SeqScreener? HOT 1
- SuperDeduper ignoring reads HOT 6
- hts_Primers doesn't seem to read multi-fasta files correctly
- hts_Primers - error message HOT 4
- Version incorrect and CMAKE_PREFIX_PATH not working HOT 5
- How to cite HTStream? :-) HOT 2
- hts_LengthFilter is missing from the documentation!
- citation? HOT 2
- Add to CutTrim, trim to length from 5' or 3'
- pointer error in hts_Stats HOT 1
- Compiling from source fails on Ubuntu 22.04.1 HOT 2
- Remaining adapter sequence
- Order of input files to hts_SeqScreener changes hits reported when R1/R2 lengths differ
- "no such file or directory" error HOT 2
- munmap_chunk(): invalid pointer error HOT 3
- Issue in Common: Memory Leak in `check_open_r` (not closing file) HOT 2
- Mac version available on github, via Brew, and on bioconda is outdated
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from htstream.