Comments (2)
The --mc
flag is for passing a multi FASTA file of what sequences you put into the sample (i.e. spike-in control). From the headers, these look like FASTQ headers? So it should look something like this:
>Mock1
ATTCCAGAGGGAGAGATAGAGAGAT
>Mock2
TTTTCCGGCGCGCGCGCGAGAGAG
etc
Simplify your FASTA headers, perhaps an abbreviation of the species or a mock1, mock2, mock3 convention.
from amptk.
I was pointing to the FASTA contig file being created from step 1 containing all of the mock community reads, rather than the FASTA containing the original community. This can be closed.
from amptk.
Related Issues (20)
- Issue installing AMPtk (Mac OS - M1 chip) HOT 2
- getting NoneType vs int error in clustering step
- Error when run quick start HOT 7
- usearch9 not found when generate UTAX database
- VSEARCH error on amptk -filter step
- Support Python 3.8 onwards HOT 3
- SyntaxError in "duplicate ID in mapping file: XXX, exiting"
- Default for -p, --index_bleed documented as 0.005 HOT 1
- Typo "Bjerkandara adusta" --> "Bjerkandera adusta" HOT 1
- Missing species names in amptk_mock1.fa HOT 3
- Missing final new line in amptk_mock1.fa and amptk_synmock.fa HOT 2
- Inconsistent primer trimming sequence in amptk_mock*.fa HOT 5
- Matching MockA, MockB1 and MockB2 to FASTQ filenames HOT 2
- platform.linux_distribution is removed since Python 3.8 HOT 1
- Species names in amptk_mock2.fa and amptk_mock3.fa vs Figure 4
- new users cannot install amptk properly, please help HOT 3
- unoise3 clustering HOT 5
- Problem with TypeError during AMPtk cluster HOT 11
- Saw you started some prelim ONT methods HOT 2
- Problematic unoise3 implementation with VSEARCH HOT 13
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from amptk.