mateog4712 / iterative-hfold

RNA Pseudoknotted Secondary Structure Prediction Using Relaxed Hierarchical Folding

HFold Iterative

Description:

Software implementation of Iterative HFold.
Iterative HFold is an algorithm for predicting the pseudoknotted secondary structures of RNA using relaxed Hierarchical Folding.

Paper: Jabbari, H., Condon, A. A fast and robust iterative algorithm for prediction of RNA pseudoknotted secondary structures. BMC Bioinformatics 15, 147 (2014). https://doi.org/10.1186/1471-2105-15-147 (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-15-147)

On the dataset tested in this paper, Iterative HFold generally has better accuracy that its predecessor, HFold.

Supported OS:

Linux, macOS

Conda Package:

conda install -c uvic-cobra iterative-hfold

Works for Linux and macOS

Source code Installation:

Requirements: A compiler that supports C++11 standard (tested with g++ version 4.9.0 or higher), Pthreads, and CMake version 3.1 or greater.

CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:

cmake --version

If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.

Mac:

Easiest way is to install homebrew and use that to install CMake.
To do so, run the following from a terminal to install homebrew:  

/usr/bin/ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install)"   

When that finishes, run the following from a terminal to install CMake.    

brew install cmake   

Linux:

Run from a terminal

wget http://www.cmake.org/files/v3.8/cmake-3.8.2.tar.gz
tar xzf cmake-3.8.2.tar.gz
cd cmake-3.8.2
./configure
make
make install

Linux instructions source

Steps for installation

1. Download the repository and extract the files onto your system.
2. From a command line in the root directory (where this README.md is) run

cmake -H. -Bbuild
cmake --build build

If you need to specify a specific compiler, such as g++, you can instead run something like

cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build

This can be useful if you are getting errors about your compiler not having C++11 features.

Help

Usage: Iterative-HFold[options] [input sequence]

Read input file from cmdline; predict minimum free energy and optimum structure using the RNA folding algorithm.

  -h, --help             Print help and exit
  -V, --version          Print version and exit
  -v, --verbose          Give verbose output
  -r, --input-structure  Give a restricted structure as an input structure
  -i, --input-file       Give a path to an input file containing the sequence (and input structure if known)
  -o, --output-file      Give a path to an output file which will the sequence, and its structure and energy
  -n, --opt              Specify the number of suboptimal structures to output (default is 1)
  -d  --dangles          Specify the dangle model to be used (base is 2)
  -P, --paramFile        Read energy parameters from paramfile, instead of using the default parameter set.\n
      --noConv           Do not convert DNA into RNA. This will use the Matthews 2004 parameters for DNA

How to use:

    Remarks:
        make sure the <arguments> are enclosed in "", for example -r "..(...).." instead of -r ..(...)..
        The sequence does not need to be enclosed and can be given before or after the other arguments
        if no structure is provided through -r , the input structure will be the hotspot with the lowest free energy
        if -i is provided with just a file name without a path, it is assuming the file is in the diretory where the executable is called
        if -o is provided with just a file name without a path, the output file will be generated in the diretory where the executable is called
        if -v is provided, a verbose output will be given (method used is outputted)
        if -V is provided, the version is given
        if -n is provided with a number, it will modify the number of hotspots looked and outputs given (the base is 1), repeated structures are skipped. That is, if different input structures come to the same conclusion, only those that are different are shown
        If no input structure is given, or suboptimal structures are greater than the number given, CParty generates hotspots to be used as input structures -- where hotspots are energetically favorable stems
        The default parameter file is Turner2004. This can be changed via -P and specifying the parameter file you would like

Sequence requirements:
    containing only characters GCAU

Structure requirements:
    -pseudoknot free
    -containing only characters .x()
    Remarks:
        Restricted structure symbols:
            () restricted base pair
            . no restriction
            x restricted to unpaired

Input file requirements:
        Line1: Name (optional, but must be fasta format; ignored in final input)
        Line2: Sequence (required)
        Line3: Structure (optional)
    sample:
        >Srp_005
        GCAACGAUGACAUACAUCGCUAGUCGACGC
        (............................)

Example:

assume you are in the directory where the HFold_iterative executable is loacted
./build/Iterative-HFold -i "/home/username/Desktop/myinputfile.txt"
./build/Iterative-HFold -i "/home/username/Desktop/myinputfile.txt" -o "outputfile.txt"
./build/Iterative-HFold -i "/home/username/Desktop/myinputfile.txt" -o "/home/username/Desktop/some_folder/outputfile.txt"
./build/Iterative-HFold GCAACGAUGACAUACAUCGCUAGUCGACGC -r "(____________________________)"
./build/Iterative-HFold GCAACGAUGACAUACAUCGCUAGUCGACGC -r "(____________________________)" -o "outputfile.txt"
./build/Iterative-HFold -d1 GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/Iterative-HFold GCAACGAUGACAUACAUCGCUAGUCGACGC -n 10
./build/Iterative-HFold -P "src/params/parameters_DP09.txt" GCAACGAUGACAUACAUCGCUAGUCGACGC 

Questions

For questions, you can email [email protected]