junchaoshi / sports1.1 Goto Github PK

Small non-coding RNA annotation Pipeline Optimized for rRNA- and tRNA-Derived Small RNAs

License: GNU General Public License v3.0

Perl 86.96% R 13.04%

small-rna rna-seq-analysis rna-seq-mapping trna-derived-small-rna rrna-derived-small-rna mirna pirna tsrna rsrna modification

sports1.1's Introduction

SPORTS1.1 (Small non-coding RNA annotation Pipeline Optimized for rRNA- and tRNA-Derived Small RNAs)

If you use SPORTS1.1 in your work, please cite this paper:

SPORTS1.0: a tool for annotating and profiling non-coding RNAs optimized for rRNA-and tRNA-derived small RNAs

Junchao Shi, Eun-A Ko, Kenton M. Sanders, Qi Chen, Tong Zhou. SPORTS1.0: a tool for annotating and profiling non-coding RNAs optimized for rRNA-and tRNA-derived small RNAs. Genomics, Proteomics & Bioinformatics (2018) doi.org/10.1016/j.gpb.2018.04.004

Requirements

Installation

Script description

Example usage

Pre-compiled annotation databases instruction

Instruction for compiling annotation database by user

Update history

Disclaimer

Contact information

Requirements

Linux system, enough disk space and Ram depending on the size of RNA deep sequencing data. (Tested system: ubuntu 12.04 LTS, ubuntu 16.04 LTS)

Installation

Download SPORTS1.1 pipeline package.

wget https://github.com/junchaoshi/SPORTS1.1/archive/master.zip
Download necessary software, packages and reference databases as listed below:
1. Perl 5 (https://www.perl.org) (Tested version: v5.14.2, v5.22.1); Perl 5 might be already installed in the linux system.
2. Bowtie [1] (http://bowtie-bio.sourceforge.net/index.shtml) (Tested version: 1.1.2, 1.2.1.1)
3. SRA Toolkit (https://github.com/ncbi/sra-tools) (Tested version: 2.8.2)
  
  cutadapt [2] (http://cutadapt.readthedocs.io/en/stable/index.html) (Tested version: 1.11)
4. R (https://www.r-project.org/) (Tested version: 3.2.3, 3.2.5)
5. Reference database (See lists and download link of all pre-compiled species’ databases in Pre-compiled Databases Instruction)
Installation tutorial for software and packages.
1. Install SPORTS1.1
  1. Unpack SPORTS1.1 package.
    
    unzip SPORTS1.1-master.zip
  2. Attach the SPORTS directory to your PATH:
    
    echo 'export PATH=$PATH:your_path_to_SPORTS1.1-master/source' >> ~/.bashrc
    
    chmod 755 your_path_to_SPORTS1.1-master/source/sports.pl
2. Install Bowtie
  1. Unpack bowtie-1.x.x-linux-x86_64.zip.
    
    unzip bowtie-1.x.x-linux-x86_64.zip
  2. Attach the bowtie directory to your PATH:
    
    echo 'export PATH=$PATH:your_path_to_bowtie' >> ~/.bashrc
```
If you are administrator user, type the following command and password to easily install bowtie:

sudo apt-get install bowtie
```
3. Install SRA Toolkit
  1. Unpack SRA toolkit files.
  2. Attach the SRA Toolkit executable path to your PATH:
    
    echo 'export PATH=$PATH:your_path_to_sra-toolkit/bin' >> ~/.bashrc
4. Install cutadapt
  1. Use pip on the command line to install latest version of cutadapt:
    
    pip install --user --upgrade cutadapt
  2. Attach the cutadapt directory to your PATH:
    
    echo 'export PATH=$PATH:$HOME/.local/bin' >> ~/.bashrc
5. Install R and R package
  1. Unpack R-x.y.z.tar.gz with:
    
    tar -xf R-x.y.z.tar.gz
  2. Enter into the R-x.y.z directory:
    
    cd R-x.y.z
  3. Type following command in terminal:
```
./configure

make

make check

make install
```
  4. Install R packages by typing following command in terminal:
```
R

install.packages('ggplot2', dependencies=TRUE, repos='http://cran.rstudio.com/')

install.packages('data.table', dependencies=TRUE, repos='http://cran.rstudio.com/')

install.packages('stringr', dependencies=TRUE, repos='http://cran.rstudio.com/')

q()

n
```
Start a new shell session to apply changes to environment variables:

source ~/.bashrc

Test if everything is installed properly:

perl -v

sports.pl -h

bowtie

fastq-dump

cutadapt -h

R --version

If you get any error messages you should install the software once again.

Script description

sports.pl

Input query format:
1. .sra files.
2. .fastq/.fq, .fasta/.fa files of deep sequencing reads.
```
Attention: compressed files need to be unpacked before input!
```

Options:

--Input:

 -i <file> Input could be: 
 
     a .sra, .fastq/.fq or .fasta/.fa file;

     a directory (will run all qualified files in the directory recursively); 

     a text document (with suffix .txt) with absolute path information for each file/folder (when processing multiple data, input each file/folder path per line)

--Output:

 -o <str> output address of annotation results (default: input address)
  
 -k keep all the intermediate files generated during the running progress

--Alignment:

 -l <int> the minimal length of the output sequences (default = 15)

 -L <int> the maximal length of the output sequences (default = 45)

 -M <int> the total number of mismatches in the entire alignment (default = 0)
 
 -a  Remove 5' / 3' adapters

     -x <str> (if -a applied) 5' adapter sequence. Default = "GTTCAGAGTTCTACAGTCCGACGATC"

     -y <str> (if -a applied) 3' adapter sequence. Default = "TGGAATTCTCGGGTGCCAAGG"

--Others:

 -v print version information
 
 -h print this usage message

Example
- Example use 1:
The user wants to map a single fasta file against rat reference genome to get the mapping genome annotation only. (No output figures)

Type following command in terminal:

sports.pl -i reads.fa -g /foo/bar/Rattus_norvegicus/UCSC/rn6/Sequence/BowtieIndex/genome
- Example use 2:
The user wants to map several already trimed human sequencing files to human reference genome, miRNA database, tRNA database, rRNA database and piRNA database by using 4 CPU threads, then to output the result to the address: '/foo/bar/output/'.

Write all the fastq files' addresses into a text document with suffix .txt, e.g.:
```
seq_address.txt
---------------------------
/foo/bar/fold_1/seq_1.fastq
/foo/bar/fold_2/seq_2.fq
/foo/bar/fold_2/seq_3.fq
/foo/bar/fold_3/seq_4.fasta
/foo/bar/fold_4/seq_5.fa
---------------------------
```
Type following command in terminal:

sports.pl -i seq_address.txt -p 4 -g /foo/bar/Homo_sapiens/genome/hg38/genome -m /Homo_sapiens/miRBase/21/miRBase_21-has -r /foo/bar/Homo_sapiens/rRNAdb/human_rRNA -t /foo/bar/Homo_sapiens/GtRNAdb/hg19/hg19-tRNAs -w /foo/bar/Homo_sapiens/piRBase/piR_human -o /foo/bar/output/
- Example use 3:
The user wants to map several untrimmed mouse sequencing files downloaded from NCBI or somewhere else to mouse reference genome, miRNA database, tRNA database, rRNA database, piRNA database, ensembl noncoding RNA database and Rfam database by using 4 CPU threads, then to output the result to the address: '/foo/bar/output/' and keep all the intermediate files generated during the running progress.
```
Put all the sequencing files into a folder, e.g.:

folder structure:

------------------------
download_seq
   │
   ├─fold_1
   │   │
   │   ├─seq_1.sra
   │   │
   │   └─seq_2.sra
   │
   ├─fold_2
   │   │
   │   ├─fold_3
   │   │   │
   │   │   ├─seq_3.fastq
   │   │   │
   │   │   └─seq_4.fq
   │   │
   │   └─seq_5.fasta
   │
   └─seq_6.fa
------------------------
```
Type following command in terminal:

sports.pl -i /foo/bar/download_seq/ -p 4 -a -x GTTCAGAGTTCTACAGTCCGACGATC -y TGGAATTCTCGGGTGCCAAGG -g /foo/bar/Mus_musculus/genome/mm10/genome -m /foo/bar/Mus_musculus/miRBase/21/miRbase_21-mmu -r /foo/bar/Mus_musculus/rRNAdb/mouse_rRNA -t /foo/bar/Mus_musculus/GtRNAdb/mm10/mm10-tRNAs -w /foo/bar/Mus_musculus/piRBase/piR_mouse -e /foo/bar/Mus_musculus/Ensembl/Mus_musculus.GRCm38.ncrna -f /foo/bar/Mus_musculus/Rfam/12.3/Rfam-12.3-mouse -o /foo/bar/output/ -k
Example output file structure for 1 query file input (e.g. SeqFile):

    Output folder structure
       │
       ├─1_SeqFile
       │   │
       │   ├─SeqFile_fa (if -k applied)
       │   │   │
       │   │   ├SeqFile.fa					---unique seqs with reads number
       │   │   │
       │   │   ├SeqFile_disgarded_reads.fa			---seqs that cannot pass adapter removing process  
       │   │   │
       │   │   ├SeqFile_too_short_reads.fa			---seqs that are lower than required minimal length threshold
       │   │   │
       │   │   ├SeqFile_too_long_reads.fa			---seqs that are higher than required maximal length threshold
       │   │   │
       │   │   ├SeqFile_match_genome.fa				---seqs that can match to reference genome
       │   │   │
       │   │   ├SeqFile_unmatch_genome.fa			---seqs that cannot match to reference genome
       │   │   │
       │   │   ├SeqFile_match_<X>_match_genome.fa		---seqs that can match to both <X> database and reference genome
       │   │   │
       │   │   ├SeqFile_match_<X>_unmatch_genome.fa		---seqs that can match to <X> database but not reference genome
       │   │   │
       │   │   ├SeqFile_unmatch_<X>_match_genome.fa		---seqs that cannot match to <X> database but can match to reference genome
       │   │   │
       │   │   └SeqFile_unmatch_<X>_unmatch_genome.fa		---seqs that match to <X> rfam database nor reference genome
       │   │
       │   ├SeqFile_processed (if -k applied)
       │   │   │
       │   │   ├SeqFile_output_match_genome			---seqs that match to reference genome in BOWTIE format
       │   │   │
       │   │   ├SeqFile_output_<X>_match_genome			---seqs that match to both miRNA database and reference genome in BOWTIE format
       │   │   │
       │   │   └SeqFile_output_<X>_unmatch_genome		---seqs that match to miRNA database but not reference genome in BOWTIE format
       │   │
       │   └SeqFile_result
       │       │
       │       ├SeqFile_output.txt				---6 column table file including annotation information for every unique sequence
       │       │
       │       ├SeqFile_summary.txt				---3 column table file including reads number of each major- (e.g. rRNA) and sub- (e.g. 5S rRNA) classes
       │       │
       │       ├SeqFile_length_distribution.txt			---3 column table file including reads number of each length distribution of each major class
       │       │
       │       ├SeqFile_mismatch_summary.txt			---11 column table file including mismatch statistics information for each mismatch loci (if -M >0)
       │       │
       │       ├SeqFile_sncRNA_distribution.pdf			---figure of length distribution of miRNA, rsRNA, tsRNA, piRNA and other RNAs, if sequence matches existed
       │       │
       │       ├SeqFile_rRNA_distribution.pdf			---figure of length distribution of different types of rRNAs, if sequence matches existed
       │       │
       │       ├SeqFile_rRNA_mapping.pdf			---figure of rsRNAs mapping against different types of rRNAs, if sequence matches existed
       │       │
       │       └SeqFile_tRNA_mapping.pdf			---figure of length distribution of different types of tRNAs, if sequence matches existed
       │
       ├─processing_report (if -k applied)
       │   │
       │   └1_SeqFile.txt					---processing log file
       │
       └─sh_file (if -k applied)
           │   
           └1__SeqFile.sh					---processing script file

    Some output folders only exist when '-k' parameter is applied in sports.pl;
    
    SeqFile_mismatch_summary.txt only exist when '-M' parameter is lager than 0 in sports.pl;
    
    Some output files might not exist if the file size is zero.

fastq2fasta.pl

Extracted from miRDeep2 [3] (https://github.com/rajewsky-lab/mirdeep2)

Description:

Parses fastq format files into fasta format.
Input:

A fastq file.
Output:

A fasta file, one sequence per line (the sequences are expanded).
options:

-
Example usage:

fastq2fasta.pl reads.fq > reads.fa

fastaparse.pl

Extracted from miRDeep2 [3] (https://github.com/rajewsky-lab/mirdeep2)

Description:

Performs simple filtering of entries in a fasta file.
Input:

A fasta file
Output:

A filtered fasta file
Options:

-a only output entries where the sequence is minimum int nts long

-b remove all entries that have a sequence that contains letters other than a,c,g,t,u,n,A,C,G,T,U,N.

-s output progress
Example usage:

fastaparse.pl reads.fa -a 15 -s > reads_no_short.fa 2> reads_discarded.fa

combine_reads.pl

Description:

Combine reads in the fasta file to get unique sequence and its read number.
Input:

A fasta file
Output:

    A filtered fasta file.
    --------------------------------
    >t00000001 1234567
    TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGC
    --------------------------------
    't00000001' is the unique ID of the sequence, representing the abundance ranking among all the sequences. In this case, the abundance of this sequence is the highest.
    '1234567' represents the reads number of sequence 'TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGC'

Options:

-
Example usage:

combine_reads.pl reads.fa > combined_reads.fa

tRNA_db_processing.pl

Description:

This script adds CCA end to original genomic tRNA 3’ end and add G to Histidine tRNA 5’ end.
Input:

The reference tRNA database file in .fa format

A fasta file
Options: -
Example usage:

tRNA_db_processing.pl input_tRNA_file.fa

annotation.pl

Description:

Combine the annotation information generated from sports.pl
Input:

sports.pl output folder address: <SPORTS_output_fold_address>

Output:

<seq_fold>_output.txt: A 6 column table file including annotation information for every unique sequence.

    -------------------------------------------------------------------------------------------------------------
    ID           Sequence                            Length    Reads      Match_Genome    Annotation
    t00000001    TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGC    32        1234567    Yes             tRNA-Glu-CTC_5_end
    -------------------------------------------------------------------------------------------------------------

    -ID: t00000001                                 --Represents the unique ID of the sequence, represents the abundance ranking among all the sequences. In this case, the abundance of this sequence is the highest.

    -Sequence: TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGC    --Represents the sequence.

    -Length: 32                                    --Length of the sequence.

    -Reads: 1234567                                --Reads number of the sequence.

    -Match_Genome: Yes                             --If the sequence can match the reference genome.

    -Annotation: tRNA-Glu-CTC_5_end                --The annotation of the sequence. This sequence mapped against the 5' end of tRNA-Glu-CTC sequence.

<seq_fold>_summary.txt: A 3 column table file including reads number of each major- and sub- classes.

    -------------------------------------------------------------------------------------------------------------
    Class                             Sub_Class             Reads
    tRNAdb-tRNA_5_end_Match_Genome    -                     123456
    -                                 tRNA-Glu-CTC_5_end    78910
    -------------------------------------------------------------------------------------------------------------

    -Class: tRNAdb-tRNA_5_end_Match_Genome    --The major class name.
    -Sub_Class: tRNA-Glu-CTC_5_end            --The sub class name.
    -Reads: 123456                            --The reads number of the class.

<seq_fold>_length_distribution.txt: A 3 column table file including reads number of each length distribution of each major class.

    -------------------------------------------------------------------------------------------------------------
    Class                             Length    Reads
    tRNAdb-tRNA_5_end_Match_Genome    30        1234
    tRNAdb-tRNA_5_end_Match_Genome    31        23456
    tRNAdb-tRNA_5_end_Match_Genome    32        34567
    tRNAdb-tRNA_5_end_Match_Genome    33        4567
    ......
    -------------------------------------------------------------------------------------------------------------

    -Class: tRNAdb-tRNA_5_end_Match_Genome    --The major class name.
    -Length: 30                               --Length of the sequence.
    -Reads: 1234                              --The reads number of the class.

Options:

-
Example usage:

annotation.pl <SPORTS_output_fold_address>

tRNA_mapping.pl

Description:

Perl script calculates expression level of genomic loci by bowtie 1 output information.
Input:

bowtie 1 output file
Output:

expression summary file
Options:

-
Example usage:

tRNA_mapping.pl bowtie_output_file summary_file

mismatch_summary.pl

Description:

Perl script summarizes mismatch information generated by Bowtie 1 if parameter '-M' >0 applied in sports.pl
Input:

bowtie 1 output file and threshold of reads number.
Output:

mismatch summary file
Options:

-
Example usage:

mismatch_summary.pl bowtie_output_file 10 > mismatch_summary.txt

overall_RNA_length_distribution.R

Description:

Generate figure of length distribution of miRNA, rsRNA, tsRNA, piRNA and other RNAs, if sequence matches exists.
Input:

Files generated by annotation.pl
Output:

<seq_fold>_sncRNA_distribution.pdf Generate figure of length distribution of different types of rRNAs, if sequence matches exists.
Options:

-
Example usage:

Rscript --vanilla overall_RNA_length_distribution.R <SPORTS_output_fold_address> <dataset_name>

rRNA_length_distribution.R

Description:

Generate figure of length distribution of different types of rRNAs, if sequence matches exists. (e.g. 4.5S, 5S, 5.3S, 5.8S, 12S, 16S, 18S, 28S, 45S ...)
Input:

Files generated by annotation.pl
Output:

<seq_fold>_rRNA_distribution.pdf
Options:

-
Example usage:

Rscript --vanilla r_RNA_length_distribution.R <SPORTS_output_fold_address> <dataset_name> <rRNA_length>

rRNA_mapping.R

Description:

Generate figure of rsRNAs mapping against different types of rRNAs if sequence matches existed. (e.g. 4.5S, 5S, 5.3S, 5.8S, 12S, 16S, 18S, 28S, 45S ...)
Input:

Files generated by annotation.pl
Output:

<seq_fold>_rRNA_mapping.pdf
Options:

-
Example usage:

Rscript --vanilla rRNA_mapping.R <SPORTS_output_fold_address> <dataset_name>

tRNA_mapping.R

Description:

Generate figure of rsRNAs mapping against different types of tRNAs if sequence matches existed.
Input:

Files generated by tRNA_mapping.pl
Output:

<seq_fold>_tRNA_mapping.pdf
Options:

-
Example usage:

Rscript --vanilla tRNA_mapping.R <SPORTS_output_fold_address>_tRNA_mapping.txt <dataset_name>_tRNA_mapping.pdf

mismatch_stat.R

Description:

Generate statistics result for mismatch information generated from mismatch_summary.pl
Input:

File generated by mismatch_summary.pl and base-calling error
Output:

<seq_fold>_mismatch_summary.txt
Options:

-
Example usage:

Rscript --vanilla mismatch_stat.R <SPORTS_output_fold_address>_mismatch_summary.txt 0.01

Pre-compiled annotation databases instruction

Available species lists of bowtie-index based reference database

    To build bowtie-index of your own:
        cd /foo/bar/your_reference_database/
        bowtie-build <your_reference_database_name>.fa <your_reference_database_name>
    The built bowtie index will be: /foo/bar/your_reference_database/your_reference_database_name
	
    Unpack reference genome (e.g. human genome):
        tar zxvf Homo_sapiens_UCSC_hg38.tar.gz

Main database source:

-mirbase database [4] (Original source: http://www.mirbase.org/index.shtml)

-rRNA database (Original source: https://www.ncbi.nlm.nih.gov/nuccore)

-GtRNAdb database [5] (Original source: http://gtrnadb.ucsc.edu/)

-mitotRNAdb database [6] (Original source: http://mttrna.bioinf.uni-leipzig.de/mtDataOutput/)

-piRBase database [7] (Original source: http://www.regulatoryrna.org/database/piRNA/)

-piRNABank [8] (Original source: http://pirnabank.ibab.ac.in/index.shtml)

-ensembl ncRNA database [9] (Original source: http://www.ensembl.org/index.html)

-rfam database [10] (Original source: http://rfam.xfam.org/)

To download annotation databases of mulitple species please use this link: https://ncrnainfo-my.sharepoint.com/:f:/g/personal/sports_ncrna_info/EvZP50IfGFRJlNJwZRujI00BM-CP_w7gITsv8iU45m1rxQ?e=Pk89b9

Homo sapiens (Human)

annotation databases: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0773ed3d5f6b74f35bbd643e1af221c31&authkey=AcRxf8walnGUIEhgI--8CDc)
SPORTS1.1 related parameters if you download recommended reference database:

    -g /<your_defined_address>/Homo_sapiens/genome/hg38/genome
    -m /<your_defined_address>/Homo_sapiens/miRBase/21/miRBase_21-hsa
    -r /<your_defined_address>/Homo_sapiens/rRNAdb/human_rRNA
    -t /<your_defined_address>/Homo_sapiens/GtRNAdb/hg19/hg19-tRNAs
    -w /<your_defined_address>/Homo_sapiens/piRBase/piR_human
    -e /<your_defined_address>/Homo_sapiens/Ensembl/release-89/Homo_sapiens.GRCh38.ncrna
    -f /<your_defined_address>/Homo_sapiens/Rfam/12.3/Rfam-12.3-human

Gorilla gorilla gorilla (Gorilla)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=03a9a8d26cca14b458007e9c6ee4541f7&authkey=Aag33OX-IjvagRWePhYNF3k)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Gorilla_gorilla/UCSC/gorGor5/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Gorilla_gorilla/miRBase_21/miRBase_21-ggo
-t /<your_defined_address>/Gorilla_gorilla/GtRNAdb/gorGor3-tRNAs
-f /<your_defined_address>/Gorilla_gorilla/Rfam_12.3/Rfam-12.3-gorilla
```
Pan paniscus (Bonobo)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=03a74e9f6c2594f1e86a31acd8e554621&authkey=AYrgOm8rrAY7hrFYQ03gmTA)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Pan_paniscus/UCSC/panPan1/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Pan_paniscus/miRBase_21/miRBase_21-ppa
-f /<your_defined_address>/Pan_paniscus/Rfam_12.3/Rfam-12.3-Bonobo    
```

Pan troglodytes (Chimp)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=09c13507ee7414365843de3450aa9ad3e&authkey=AdsLOHA5q2--SbiP2C6Qjpc)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Pan_troglodytes/UCSC/panTro4/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Pan_troglodytes/miRBase_21/miRBase_21-ptr
-t /<your_defined_address>/Pan_troglodytes/GtRNAdb/panTro4-tRNAs
-e /<your_defined_address>/Pan_troglodytes/Ensembl/Pan_troglodytes.CHIMP2.1.4.ncrna
-f /<your_defined_address>/Pan_troglodytes/Rfam_12.3/Rfam-12.3-chimp

Pongo abelii (Orangutan)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=037168296877942ecb9735f26afcb450a&authkey=AZkU5ib3A0KOiT4KxrhgTGQ)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Pongo_abelii/UCSC/ponAbe2/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Pongo_abelii/miRBase_21/miRBase_21-ppy
-t /<your_defined_address>/Pongo_abelii/GtRNAdb/ponAbe2-tRNAs
-e /<your_defined_address>/Pongo_abelii/Ensembl/Pongo_abelii.PPYG2.ncrna
-f /<your_defined_address>/Pongo_abelii/Rfam_12.3/Rfam-12.3-orangutan

Nomascus leucogenys (Gibbon)

6.1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=068ef6629d31b4fb28100f667050be1d1&authkey=AWEPi3HUmOVD_PPPnkMhdvs)

6.2 SPORTS1.1 related parameters if you download recommended reference database:
```
 ``` 
 -g /<your_defined_address>/Nomascus_leucogenys/UCSC/nomLeu3/Sequence/BowtieIndex/genome
 -t /<your_defined_address>/Nomascus_leucogenys/GtRNAdb/nomLeu3-tRNAs
 -f /<your_defined_address>/Nomascus_leucogenys/Rfam_12.3/Rfam-12.3-gibbon
 ``` 
```

Macaca mulatta (Rhesus)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=07fededf7468444ba9b863b74316b8504&authkey=Aa6X06J4ExLvKtH8mJ-CESs)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Macaca_mulatta/UCSC/rheMac8/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Macaca_mulatta/miRBase_21/miRBase_21-mml
-r /<your_defined_address>/Macaca_mulatta/rRNAdb/rhesus_rRNA
-t /<your_defined_address>/Macaca_mulatta/GtRNAdb/rheMac3-tRNAs
-f /<your_defined_address>/Macaca_mulatta/Rfam_12.3/Rfam-12.3-rhesus

Papio anubis (Baboon)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=03a22a2092c7b46fb93a8fc49cf234720&authkey=Ad_hzH3MUIMh0-9BLoH_Vmw)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Papio_anubis/UCSC/papAnu2/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Papio_anubis/GtRNAdb/papAnu2-tRNAs
-f /<your_defined_address>/Papio_anubis/Rfam_12.3/Rfam-12.3-baboon
```
Callithrix jacchus (Marmoset)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=077698888fa8d40408df8c979e91146e4&authkey=AeoDYl5a3lKyF-CWgupu6IA)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Callithrix_jacchus/UCSC/calJac3/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Callithrix_jacchus/rRNAdb/marmoset_rRNA
-t /<your_defined_address>/Callithrix_jacchus/GtRNAdb/calJac3-tRNAs
-f /<your_defined_address>/Callithrix_jacchus/Rfam_12.3/Rfam-12.3-marmoset
```
Carlito syrichta (Tarsier)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0c761313792b64396b87a66a6e04101be&authkey=AZBsjTA5-hXdASOIimxNL4I)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Carlito_syrichta/UCSC/tarSyr2/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Carlito_syrichta/GtRNAdb/tarSyr2-tRNAs
-f /<your_defined_address>/Carlito_syrichta/Rfam_12.3/Rfam-12.3-tarsier
```

Rattus norvegicus (rat)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0b2cacd8453104b2abb60298863fc4c16&authkey=AZAYeCOsLKuc_ml-QMqBJoQ)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Rattus_norvegicus/UCSC/rn6/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Rattus_norvegicus/miRBase_21/miRBase_21-rno
-r /<your_defined_address>/Rattus_norvegicus/rRNAdb/mouse_rRNA
-t /<your_defined_address>/Rattus_norvegicus/GtRNAdb/rn5-tRNAs
-w /<your_defined_address>/Rattus_norvegicus/piRBase/piR_rat
-e /<your_defined_address>/Rattus_norvegicus/Ensembl/Rattus_norvegicus.Rnor_6.0.ncrna
-f /<your_defined_address>/Rattus_norvegicus/Rfam_12.3/Rfam-12.3-rat

Mus musculus (mouse)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0833653a140eb47f098267d7a23d3b63c&authkey=Ab8aoYC8paqFI2yRabIo7Ok)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Mus_musculus/genome/mm10/genome
-m /<your_defined_address>/Mus_musculus/miRBase/21/miRBase_21-mmu
-r /<your_defined_address>/Mus_musculus/rRNAdb/mouse_rRNA
-t /<your_defined_address>/Mus_musculus/GtRNAdb/mm10/mm10-tRNAs
-w /<your_defined_address>/Mus_musculus/piRBase/piR_mouse
-e /<your_defined_address>/Mus_musculus/Ensembl/release-89/Mus_musculus.GRCm38.ncrna
-f /<your_defined_address>/Mus_musculus/Rfam/12.3/Rfam-12.3-mouse

Cricetulus griseus (Hamster)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0b0ac3830026f4007958774cbdb421632&authkey=AZnURBxU1PYzUO1yyrcoZ_M)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Cricetulus_griseus/UCSC/criGri1/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Cricetulus_griseus/miRBase_21/miRBase_21-cgr
-r /<your_defined_address>/Cricetulus_griseus/rRNA_db/hamster_rRNA
-t /<your_defined_address>/Cricetulus_griseus/GtRNAdb/criGri1-tRNAs
-f /<your_defined_address>/Cricetulus_griseus/Rfam_12.3/Rfam-12.3-hamster

Cavia porcellus (Guinea pig)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0d27261e6ae9c4402bbc9465addb544de&authkey=Ad1xlk56DNm0StozUWDqCYw)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Cavia_porcellus/UCSC/cavPor3/Sequence/BowtieIndex/genome
-r /<your_defined_address>/Cavia_porcellus/rRNA_db/guinea_rRNA
-t /<your_defined_address>/Cavia_porcellus/GtRNAdb/cavPor3-tRNAs
-f /<your_defined_address>/Cavia_porcellus/Rfam_12.3/Rfam-12.3-guinea
```
Heterocephalus glaber (Naked mole-rat)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0ceff76c620884395899bcd385bfaa098&authkey=ATiBTnSjWKqY0zPKQOmM6kU)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Heterocephalus_glaber/UCSC/hetGla2/Sequence/BowtieIndex/genome
-r /<your_defined_address>/Heterocephalus_glaber/rRNA_db/mole_rRNA
-t /<your_defined_address>/Heterocephalus_glaber/GtRNAdb/hetGla2-tRNAs
-f /<your_defined_address>/Heterocephalus_glaber/Rfam_12.3/Rfam-12.3-mole
```
Ictidomys tridecemlineatus (Squirrel)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0419ea57bd00548cc94574d8ce9717fcd&authkey=Aa1pkb9R7850Ss3GFmB6GzM)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Ictidomys_tridecemlineatus/UCSC/speTri2/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Ictidomys_tridecemlineatus/GtRNAdb/speTri2-tRNAs
-f /<your_defined_address>/Ictidomys_tridecemlineatus/Rfam_12.3/Rfam-12.3-squirrel
```
Ochotona princeps (Pika)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=068d8da8388b74c38943e50237a259a88&authkey=AemP73yDCDiObexIk-DcRVQ)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Ochotona_princeps/UCSC/ochPri3/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Ochotona_princeps/GtRNAdb/ochPri3-tRNAs
-f /<your_defined_address>/Ochotona_princeps/Rfam_12.3/Rfam-12.3-pika
```

Oryctolagus cuniculus (Rabbit)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=01b2d69333c97448196cc69b212e92fc9&authkey=ARbwyo0-WJX10nDdXwvNygc)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Oryctolagus_cuniculus/UCSC/oryCun2/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Oryctolagus_cuniculus/miRBase_21/miRBase_21-ocu
-r /<your_defined_address>/Oryctolagus_cuniculus/rRNA_db/rabbit_rRNA
-t /<your_defined_address>/Oryctolagus_cuniculus/GtRNAdb/oryCun2-tRNAs
-f /<your_defined_address>/Oryctolagus_cuniculus/Rfam_12.3/Rfam-12.3-rabbit

Ovis aries (Sheep)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0e880ae29a16747bebf5b9afdb5956921&authkey=AYIP0UkTwtVuiul45XA7mYE)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Ovis_aries/UCSC/oviAri3/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Ovis_aries/miRBase_21/miRBase_21-oar
-t /<your_defined_address>/Ovis_aries/GtRNAdb/oviAri1-tRNAs
-f /<your_defined_address>/Ovis_aries/Rfam_12.3/Rfam-12.3-sheep
```

Bos taurus (Cow)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0a58e56dc7cb743299631fec15b72e69d&authkey=AeosGslpVMdvtZa6qtKJBCE)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Bos_taurus/UCSC/bosTau8/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Bos_taurus/miRBase_21/miRBase_21-bta
-r /<your_defined_address>/Bos_taurus/rRNA_db/cow_rRNA
-t /<your_defined_address>/Bos_taurus/GtRNAdb/bosTau8-tRNAs
-e /<your_defined_address>/Bos_taurus/Ensembl/Bos_taurus.UMD3.1.ncrna
-f /<your_defined_address>/Bos_taurus/Rfam_12.3/Rfam-12.3-cow

Sus scrofa (Pig)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0e15d39ac05b24a9b899e7a9dfcf96773&authkey=AYaNWQ9KLlkqq7f2qbWzchc)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Sus_scrofa/UCSC/susScr3/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Sus_scrofa/miRBase_21/miRBase_21-ssc
-r /<your_defined_address>/Sus_scrofa/rRNA_db/pig_rRNA
-t /<your_defined_address>/Sus_scrofa/GtRNAdb/susScr3-tRNAs
-f /<your_defined_address>/Sus_scrofa/Rfam_12.3/Rfam-12.3-pig
```
Tursiops truncatus (Dolphin)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=08396ad3619a247d695508aee771e3991&authkey=AVKuiimDuoOGVKfGvZcK_ik)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Tursiops_truncatus/UCSC/turTru2/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Tursiops_truncatus/GtRNAdb/turTru2-tRNAs
-f /<your_defined_address>/Tursiops_truncatus/Rfam_12.3/Rfam-12.3-dolphin
```
Balaenoptera acutorostrata (Minke whale)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0d27ad173ffdb4dcc8a4954f9ba5426eb&authkey=AUdYvbA-_q0lzVEEBlth8V8)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Balaenoptera_acutorostrata/UCSC/balAcu1/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Balaenoptera_acutorostrata/GtRNAdb/balAcu1-tRNAs
-f /<your_defined_address>/Balaenoptera_acutorostrata/Rfam_12.3/Rfam-12.3-whale
```
Erinaceus europaeus (Hedgehog)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0633e2d7781ab4aefb59fc03f1347657b&authkey=AXrP4XnyiHQqkC5WOUhhS5w)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Erinaceus_europaeus/UCSC/eriEur2/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Erinaceus_europaeus/GtRNAdb/eriEur2-tRNAs
-f /<your_defined_address>/Erinaceus_europaeus/Rfam_12.3/Rfam-12.3-hedgehog
```
Sorex araneus (Shrew)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0399046c56fb246c39630c84db61a23ad&authkey=AWE7pAlGt1TAAUylD4qoE9A)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Sorex_araneus/UCSC/sorAra2/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Sorex_araneus/GtRNAdb/sorAra2-tRNAs
-f /<your_defined_address>/Sorex_araneus/Rfam_12.3/Rfam-12.3-shrew
```

Canis familiaris (Dog)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=06a45d60105a04796b5e96a9417d86f4c&authkey=AY37yxKX-C5u9DG71tzrFEI)

SPORTS1.1 related parameters if you download recommended reference database (both UCSC and Ensembl genome sequences are provided):

-g /<your_defined_address>/Canis_familiaris/UCSC/canFam3/Sequence/BowtieIndex/genome

or

-g /<your_defined_address>/Canis_familiaris/Ensembl/Cfam_1.0/dna/genome

-m /<your_defined_address>/Canis_familiaris/miRBase/22.1/miRBase-cfa
-r /<your_defined_address>/Canis_familiaris/rRNAdb/dog_rRNA
-t /<your_defined_address>/Canis_familiaris/GtRNAdb/canFam3-tRNAs
-e /<your_defined_address>/Canis_familiaris/Ensembl/Cfam_1.0/rna/Canis_lupus_familiaris.ROS_Cfam_1.0.rna
-f /<your_defined_address>/Canis_familiaris/Rfam/14.7/Rfam

Mustela putorius furo (Ferret)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0ef4e067d42f241359e2e606b14e0d8f9&authkey=AUW2yr7SM356KpD5uhBNOeM)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Mustela_furo/UCSC/musFur1/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Mustela_furo/GtRNAdb/musFur1-tRNAs
-f /<your_defined_address>/Mustela_furo/Rfam_12.3-ferret
```
Ailuropoda melanoleuca (Panda)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0215799b172f94c909c5251061e317540&authkey=AdE82hkEi1MHl3OL1vY92b8)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Ailuropoda_melanoleuca/UCSC/ailMel1/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Ailuropoda_melanoleuca/GtRNAdb/ailMel1-tRNAs
-f /<your_defined_address>/Ailuropoda_melanoleuca/Rfam-12.3-panda
```
Felis catus (Cat)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0203fe1a0c8954879878ef8cabcfe37cf&authkey=AZ32jdZI7FoFU_t8_NFb9o0)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Felis_catus/UCSC/felCat8/Sequence/BowtieIndex/genome
-r /<your_defined_address>/Felis_catus/rRNA_db/cat_rRNA
-t /<your_defined_address>/Felis_catus/GtRNAdb/felCat5-tRNAs
-f /<your_defined_address>/Felis_catus/Rfam_12.3/Rfam-12.3-cat
```

Equus caballus (Horse)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0e7011a73d57545ea8be3c71335b3cf4c&authkey=AWHkBfbzVmwz_HjmQXo8IJU)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Equus_caballus/UCSC/equCab2/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Equus_caballus/miRBase_21/miRBase_21-eca
-r /<your_defined_address>/Equus_caballus/rRNA_db/horse_rRNA
-t /<your_defined_address>/Equus_caballus/GtRNAdb/equCab2-tRNAs
-f /<your_defined_address>/Equus_caballus/Rfam_12.3/Rfam-12.3-horse

Ceratotherium simum (White rhinoceros)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0f836e7106664459bacda6f94dc15e22d&authkey=AVSh1b1dr84q53sLTqD9sRA)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Ceratotherium_simum/UCSC/cerSim1/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Ceratotherium_simum/GtRNAdb/cerSim1-tRNAs
-f /<your_defined_address>/Ceratotherium_simum/Rfam_12.3/Rfam-12.3-rhinoceros
```
Myotis lucifugus (Microbat)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=03dcc351bbc274cfc8692e5f2b1f5d0f3&authkey=AbjlxSozqu1c-2sRUrTGn7k)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Myotis_lucifugus/UCSC/myoLuc2/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Myotis_lucifugus/GtRNAdb/myoLuc2-tRNAs
-f /<your_defined_address>/Myotis_lucifugus/Rfam_12.3/Rfam-12.3-bat
```
Trichechus manatus (Manatee)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=06448172c574b4b9cbe0d906cf75bc68b&authkey=AX_fEuPmr18NZPEFbcg9nEQ)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Trichechus_manatus/UCSC/triMan1/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Trichechus_manatus/GtRNAdb/triMan1-tRNAs
-f /<your_defined_address>/Trichechus_manatus/Rfam_12.3/Rfam-12.3-manatee
```
Loxodonta africana (Elephant)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0e0146e32fe4745bba50bbede409efddc&authkey=AT8bNP2DhjKysDaGD4Qy-7s)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Loxodonta_africana/UCSC/loxAfr3/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Loxodonta_africana/GtRNAdb/loxAfr3-tRNAs
-f /<your_defined_address>/Loxodonta_africana/Rfam_12.3/Rfam-12.3-elephant
```
Dasypus novemcinctus (Armadillo)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0c68adc6b2afc447a9dfe45a1a5eedd49&authkey=AUPTS51dr88E3AMvcZtljrk)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Dasypus_novemcinctus/UCSC/dasNov3/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Dasypus_novemcinctus/GtRNAdb/dasNov3-tRNAs
-f /<your_defined_address>/Dasypus_novemcinctus/Rfam_12.3/Rfam-12.3-armadillo
```
Notamacropus eugenii (Wallaby)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=076db8740d2e34caabb25669fd6297e36&authkey=AWv-dFi1Mm7C0QH9K00WHH4)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Notamacropus_eugenii/UCSC/macEug2/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Notamacropus_eugenii/miRBase_21/miRBase_21-meu
-t /<your_defined_address>/Notamacropus_eugenii/GtRNAdb/macEug2-tRNAs
-f /<your_defined_address>/Notamacropus_eugenii/Rfam_12.3/Rfam-12.3-wallaby
```
Sarcophilus harrisii (Tasmanian devil)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0469dc3788cbb40bab7472ee70a230dc0&authkey=AXA1nDb4QpYeuIJFC-D6mL0)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Sarcophilus_harrisii/UCSC/sarHar1/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Sarcophilus_harrisii/miRBase_21/miRBase_21-sha
-t /<your_defined_address>/Sarcophilus_harrisii/GtRNAdb/sarHar1-tRNAs
-f /<your_defined_address>/Sarcophilus_harrisii/Rfam_12.3/Rfam-12.3-tasmanian
```

Monodelphis domestica (Opossum)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=05e9cd2f3891a4761ade95d98aa3ebc78&authkey=Ae_jBKIdBC7HypVTN7S98Rw)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Monodelphis_domestica/UCSC/monDom5/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Monodelphis_domestica/miRBase_21/miRBase_21-mdo
-t /<your_defined_address>/Monodelphis_domestica/GtRNAdb/monDom5-tRNAs
-e /<your_defined_address>/Monodelphis_domestica/Ensembl/Monodelphis_domestica.BROADO5.ncrna
-f /<your_defined_address>/Monodelphis_domestica/Rfam_12.3/Rfam-12.3-opossum

Ornithorhynchus anatinus (Platypus)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=07f0f4ed088844a86afa5db763407699c&authkey=AUFx9yWXHtg1CQc-wfpJ81M)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Ornithorhynchus_anatinus/UCSC/ornAna2/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Ornithorhynchus_anatinus/miRBase_21/miRBase_21-oan
-t /<your_defined_address>/Ornithorhynchus_anatinus/GtRNAdb/ornAna1-tRNAs
-w /<your_defined_address>/Ornithorhynchus_anatinus/piRBase/piR_platypus
-e /<your_defined_address>/Ornithorhynchus_anatinus/Ensembl/Ornithorhynchus_anatinus.OANA5.ncrna
-f /<your_defined_address>/Ornithorhynchus_anatinus/Rfam_12.3/Rfam-12.3-platypus

Taeniopygia guttata (Zebra finch)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0defbf712045f4e7f85b373b0eba4cd1b&authkey=AbieXkq6akbsD8tY1oGctDI)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Taeniopygia_guttata/UCSC/taeGut2/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Taeniopygia_guttata/miRBase_21/miRBase_21-tgu
-t /<your_defined_address>/Taeniopygia_guttata/GtRNAdb/taeGut2-tRNAs
-f /<your_defined_address>/Taeniopygia_guttata/Rfam_12.3/Rfam-12.3-finch
```
Melopsittacus undulatus (Budgerigar)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0e0046ab3b1a9458a9a183b45507ea0c3&authkey=AWiCroVnVDQcPENZDX_76VM)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Melopsittacus_undulatus/UCSC/melUnd1/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Melopsittacus_undulatus/GtRNAdb/melUnd1-tRNAs
-f /<your_defined_address>/Melopsittacus_undulatus/Rfam_12.3/Rfam-12.3-budgerigar        
```

Gallus gallus (Chicken)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0abafb326c4074fe9971d60a26497126c&authkey=AcRw_9ltjRXbdNAfmLRl_gg)

PORTS1.0 related parameters if you download recommended reference database:

-g /<your_defined_address>/Gallus_gallus/UCSC/galGal5/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Gallus_gallus/miRBase_21/miRBase_21-gga
-r /<your_defined_address>/Gallus_gallus/rRNA_db/chicken_rRNA
-t /<your_defined_address>/Gallus_gallus/GtRNAdb/galGal4-tRNAs
-w /<your_defined_address>/Gallus_gallus/piRBase/piR_gga_v1.0
-e /<your_defined_address>/Gallus_gallus/Ensembl/Gallus_gallus.Gallus_gallus-5.0.ncrna
-f /<your_defined_address>/Gallus_gallus/Rfam_12.3/Rfam-12.3-chicken

Meleagris gallopavo (Turkey)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0c88e1661f08e4b6d945d87e8120bdf07&authkey=AWlCjj414nXNuNbrNM7mbE4)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Meleagris_gallopavo/UCSC/melGal1/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Meleagris_gallopavo/GtRNAdb/melGal1-tRNAs
-f /<your_defined_address>/Meleagris_gallopavo/Rfam_12.3/Rfam-12.3-turkey
```
Chrysemys picta (Painted Turtle)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0fbd62d91eb4442a88525f89684a74242&authkey=AY3fgBdvPRzWpqqD4yd_Sqw)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Chrysemys_picta/UCSC/chrPic1/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Chrysemys_picta/GtRNAdb/chrPic1-tRNAs
-f /<your_defined_address>/Chrysemys_picta/Rfam_12.3/Rfam-12.3-turtle
```

Anolis carolinensis (Lizard)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=06986df31c45c4a00a6a2b47ce4ee7af2&authkey=AaE-i58-1fjJeqcDHZUpLLo)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Anolis_carolinensis/UCSC/anoCar2/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Anolis_carolinensis/miRBase_21/miRBase_21-aca
-t /<your_defined_address>/Anolis_carolinensis/GtRNAdb/anoCar2-tRNAs
-e /<your_defined_address>/Anolis_carolinensis/Ensembl/Anolis_carolinensis.AnoCar2.0.ncrna
-f /<your_defined_address>/Anolis_carolinensis/Rfam_12.3/Rfam-12.3-lizard

Xenopus laevis (Frog)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0d9b3d45b3bf3483c826c36d2b340f0fd&authkey=AdGZ969RHd1lpwBpm7lsGEQ)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Xenopus_laevis/UCSC/xenTro7/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Xenopus_laevis/miRBase_21/miRBase_21-xtr
-r /<your_defined_address>/Xenopus_laevis/rRNA_db/frog_rRNA
-t /<your_defined_address>/Xenopus_laevis/GtRNAdb/xenTro3-tRNAs
-w /<your_defined_address>/Xenopus_laevis/piRBase/piR_xtr_v1.0
-e /<your_defined_address>/Xenopus_laevis/Ensembl/Xenopus_tropicalis.JGI_4.2.ncrna
-f /<your_defined_address>/Xenopus_laevis/Rfam_12.3/Rfam-12.3-frog

Latimeria chalumnae (Coelacanth)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0be8104aeb59d4ff89909d0c62d0a2f4e&authkey=AasK4DZcbB12a8wB8CNz6Ak)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Latimeria_chalumnae/UCSC/latCha1/Sequence/BowtieIndex/genome
-r /<your_defined_address>/Latimeria_chalumnae/rRNA_db/coelacanth_rRNA
-t /<your_defined_address>/Latimeria_chalumnae/GtRNAdb/latCha1-tRNAs
-f /<your_defined_address>/Latimeria_chalumnae/Rfam_12.3/Rfam-12.3-coelacanth
```
Tetraodon nigroviridis (Tetraodon)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=06252eaadd5894a3795afce052716fd17&authkey=AWZ9FVt-iphiQFRDzuKoJtA)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Tetraodon_nigroviridis/UCSC/tetNig2/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Tetraodon_nigroviridis/miRBase_21/miRBase_21-tni
-t /<your_defined_address>/Tetraodon_nigroviridis/GtRNAdb/tetNig2-tRNAs
-f /<your_defined_address>/Tetraodon_nigroviridis/Rfam_12.3/Rfam-12.3-tetraodon
```
Takifugu rubripes (Fugu)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=026501a5c4aa54930a00289acf9691f5f&authkey=AWUaDYW0_VZx-1dy5wnCfdQ)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Takifugu_rubripes/UCSC/fr3/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Takifugu_rubripes/GtRNAdb/fr3-tRNAs
-f /<your_defined_address>/Takifugu_rubripes/Rfam_12.3/Rfam-12.3-fugu
```
Gasterosteus aculeatus (Stickleback)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0268db779d3654712b39d5450bac55894&authkey=AQwh0wJeAcvF78JRu4RHddM)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Gasterosteus_aculeatus/UCSC/gasAcu1/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Gasterosteus_aculeatus/GtRNAdb/gasAcu1-tRNAs
-e /<your_defined_address>/Gasterosteus_aculeatus/Ensembl/Gasterosteus_aculeatus.BROADS1.ncrna
-f /<your_defined_address>/Gasterosteus_aculeatus/Rfam_12.3/Rfam-12.3-stickleback
```
Oryzias latipes (Medaka)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0f5089e2cc47245f28dca1a3f8f75343c&authkey=AV8N2wRviWth_LjhJqpB0zk)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Oryzias_latipes/UCSC/oryLat2/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Oryzias_latipes/miRBase_21/miRBase_21-ola
-t /<your_defined_address>/Oryzias_latipes/GtRNAdb/oryLat2-tRNAs
-f /<your_defined_address>/Oryzias_latipes/Rfam_12.3/Rfam-12.3-medaka
```
Oreochromis niloticus (Nile tilapia)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0cf791d1d99de4f4c8ed7f8de6d5694f8&authkey=AZZgbe3d1aKb7GDuCDlv81w)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Oreochromis_niloticus/UCSC/oreNil2/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Oreochromis_niloticus/GtRNAdb/oreNil2-tRNAs
-f /<your_defined_address>/Oreochromis_niloticus/Rfam_12.3/Rfam-12.3-tilapia
```
Gadus morhua (Atlantic cod)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=08f5a65a279f34d518cc4017cb04fe469&authkey=ASMQLIwmWReD_bVW922N0Io)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Gadus_morhua/UCSC/gadMor1/Sequence/BowtieIndex/genome
-r /<your_defined_address>/Gadus_morhua/rRNA_db/cod_rRNA
-t /<your_defined_address>/Gadus_morhua/GtRNAdb/gadMor1-tRNAs
-f /<your_defined_address>/Gadus_morhua/Rfam_12.3/Rfam-12.3-cod
```

Danio rerio (Zebrafish)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=07d3448d6cd29485498e70f8f067a619d&authkey=Aa1-VjshX-GKLZI7limHFIo)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Danio_rerio/UCSC/danRer10/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Danio_rerio/miRBase_21/miRBase_21-dre
-r /<your_defined_address>/Danio_rerio/rRNA_db/zebrafish_rRNA
-t /<your_defined_address>/Danio_rerio/GtRNAdb/danRer6-tRNAs
-w /<your_defined_address>/Danio_rerio/piRBase/piR_dre_v1.0
-e /<your_defined_address>/Danio_rerio/Ensembl/Danio_rerio.GRCz10.ncrna
-f /<your_defined_address>/Danio_rerio/Rfam_12.3/Rfam-12.3-zebrafish

Callorhinchus milii (Elephant shark)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=053976e5c17b9435982d22223b9389eba&authkey=ASL1VUPU4Ol2PskRXpj94t4)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Callorhinchus_milii/UCSC/calMil1/Sequence/BowtieIndex/genome
-t /<your_defined_address>/Callorhinchus_milii/GtRNAdb/calMil1-tRNAs
-f /<your_defined_address>/Callorhinchus_milii/Rfam_12.3/Rfam-12.3-shark
```
Petromyzon marinus (Lamprey)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=013a1f7a5585b462b801f1cfe3faf2cdd&authkey=AVN94xcHd1_Aa2ofYovsw8Q)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Petromyzon_marinus/UCSC/petMar2/Sequence/BowtieIndex/genome
-r /<your_defined_address>/Petromyzon_marinus/rRNA_db/lamprey_rRNA
-t /<your_defined_address>/Petromyzon_marinus/GtRNAdb/petMar2-tRNAs
-f /<your_defined_address>/Petromyzon_marinus/Rfam_12.3/Rfam-12.3-lamprey
```

Strongylocentrotus purpuratus (Sea urchin)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0840567689dbe4ff49852c8744056f172&authkey=AWhmaQmPgN5fuB1RXlKc69U)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Strongylocentrotus_purpuratus/UCSC/strPur2/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Strongylocentrotus_purpuratus/miRBase_21/miRBase_21-spu
-r /<your_defined_address>/Strongylocentrotus_purpuratus/rRNA_db/urchin_rRNA
-t /<your_defined_address>/Strongylocentrotus_purpuratus/GtRNAdb/Spurp-tRNAs
-e /<your_defined_address>/Strongylocentrotus_purpuratus/Ensembl/Strongylocentrotus_purpuratus.GCA_000002235.2.ncrna
-f /<your_defined_address>/Strongylocentrotus_purpuratus/Rfam_12.3/Rfam-12.3-urchin

Drosophila melanogaster (Drosophila)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=06d15ec2032e141648ce4eedd413b0e0c&authkey=ARejQLC8ofAhQq9IwwoB0Pw)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Drosophila_melanogaster/UCSC/dm6/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Drosophila_melanogaster/miRBase_21/miRBase_21-dme
-r /<your_defined_address>/Drosophila_melanogaster/rRNA_db/drosophila_rRNA
-t /<your_defined_address>/Drosophila_melanogaster/GtRNAdb/dm6-tRNAs
-w /<your_defined_address>/Drosophila_melanogaster/piRBase/piR_dme
-e /<your_defined_address>/Drosophila_melanogaster/Ensembl/Drosophila_melanogaster.BDGP6.ncrna
-f /<your_defined_address>/Drosophila_melanogaster/Rfam_12.3/Rfam-12.3-drosophila

Anopheles gambiae (Mosquito)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=003bfc542d06b42edb24a94969bb12b36&authkey=AdgdWQ5emWRWTYvXcgPT0Fo)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Anopheles_gambiae/UCSC/anoGam1/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Anopheles_gambiae/miRBase_21/miRBase_21-aga
-t /<your_defined_address>/Anopheles_gambiae/GtRNAdb/Agamb-tRNAs
-e /<your_defined_address>/Anopheles_gambiae/Ensembl/Anopheles_gambiae.AgamP4.ncrna
-f /<your_defined_address>/Anopheles_gambiae/Rfam_12.3/Rfam-12.3-mosquito

Pristionchus pacificus (Roundworm)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0877c09c8493b47e9b9fb6c2c0bdc6015&authkey=AQJrbZlyZz9MDnPB9uYxMYE)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Pristionchus_pacificus/UCSC/priPac1/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Pristionchus_pacificus/miRBase_21/miRBase_21-ppc
-r /<your_defined_address>/Pristionchus_pacificus/rRNA_db/roundworm_rRNA
-t /<your_defined_address>/Pristionchus_pacificus/GtRNAdb/priPac1-tRNAs
-f /<your_defined_address>/Pristionchus_pacificus/Rfam_12.3/Rfam-12.3-roundworm

Caenorhabditis elegans (Nematode):

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0cffdc7d5a3844567bc5303adca47fb81&authkey=AdA1jCVLRJkz2k8oSVU-pCI)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Caenorhabditis_elegans/UCSC/ce10/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Caenorhabditis_elegans/miRBase_21/miRBase_21-cel
-r /<your_defined_address>/Caenorhabditis_elegans/rRNA_db/cel_rRNA
-t /<your_defined_address>/Caenorhabditis_elegans/GtRNAdb/ce10-tRNAs
-w /<your_defined_address>/Caenorhabditis_elegans/piRBase/piR_cel_v1.0
-e /<your_defined_address>/Caenorhabditis_elegans/Ensembl/Caenorhabditis_elegans.WBcel235.ncrna
-f /<your_defined_address>/Caenorhabditis_elegans/Rfam_12.3/Rfam-12.3-nematode

Saccharomyces cerevisiae (Yeast)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0a974d08ffcb842dea8d18462dcfaf2f4&authkey=AQ6wsr9hNwVfCfqvuScKStE)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/BowtieIndex/genome
-r /<your_defined_address>/Saccharomyces_cerevisiae/rRNA_db/yeast_rRNA
-t /<your_defined_address>/Saccharomyces_cerevisiae/GtRNAdb/sacCer3-tRNAs
-e /<your_defined_address>/Saccharomyces_cerevisiae/Ensembl/Saccharomyces_cerevisiae.R64-1-1.ncrna
-f /<your_defined_address>/Saccharomyces_cerevisiae/Rfam_12.3/Rfam-12.3-yeast

Zea mays (Corn)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0abdce07adf9449e89bdcb89d4d4609a4&authkey=AViNEp3y6Y4hNBYSEuW_sYg)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Zea_mays/Ensembl/AGPv4/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Zea_mays/miRBase_21/miRBase_21-zma
-r /<your_defined_address>/Zea_mays/rRNA_db/corn_rRNA
-t /<your_defined_address>/Zea_mays/GtRNAdb/zeaMay5-tRNAs
-e /<your_defined_address>/Zea_mays/Ensembl/Zea_mays.AGPv4.ncrna
-f /<your_defined_address>/Zea_mays/Rfam_12.3/Rfam-12.3-corn

Sorghum bicolor (Sorghum)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0335fb9b05a024e61819c04db7ffd2a51&authkey=AdMT31NWtny7F1NzJNn3zZI)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Sorghum_bicolor/Ensembl/Sbi1/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Sorghum_bicolor/miRBase_21/miRBase_21-sbi
-r /<your_defined_address>/Sorghum_bicolor/rRNA_db/sorghum_rRNA
-t /<your_defined_address>/Sorghum_bicolor/GtRNAdb/Sbico-tRNAs
-e /<your_defined_address>/Sorghum_bicolor/Ensembl/Sorghum_bicolor.Sorghum_bicolor_v2.ncrna
-f /<your_defined_address>/Sorghum_bicolor/Rfam_12.3/Rfam-12.3-sorghum

Oryza sativa (Rice)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0510818bde4a342868928f982420dd07c&authkey=ASfslUL0BX2HYew7xrw2x1A)

SPORTS1.1 related parameters if you download recommend reference database:

-g /<your_defined_address>/Oryza_sativa/Ensembl/IRGSP-1.0/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Oryza_sativa/miRBase_21/miRBase_21-osa
-r /<your_defined_address>/Oryza_sativa/rRNA_db/rice_rRNA
-t /<your_defined_address>/Oryza_sativa/GtRNAdb/Osati-tRNAs
-e /<your_defined_address>/Oryza_sativa/Ensembl/Oryza_sativa.IRGSP-1.0.ncrna
-f /<your_defined_address>/Oryza_sativa/Rfam_12.3/Rfam-12.3-rice

Arabidopsis thaliana (Arabidopsis)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=08ec312d8fc7d4211952170468dfbb202&authkey=AeVag9p4ifZJG58C5UbXstE)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Arabidopsis_thaliana/miRBase_21/miRBase_21-ath
-r /<your_defined_address>/Arabidopsis_thaliana/rRNA_db/Arabidopsis_rRNA
-t /<your_defined_address>/Arabidopsis_thaliana/GtRNAdb/araTha1-tRNAs
-e /<your_defined_address>/Arabidopsis_thaliana/Ensembl/Arabidopsis_thaliana.TAIR10.ncrna
-f /<your_defined_address>/Arabidopsis_thaliana/Rfam_12.3/Rfam-12.3-arabidopsis

Glycine max (Soybean)
1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=079974655bb2e4f62b669c3d1701fffeb&authkey=AWVriz_LNaTMDsBjbMXDS60)
2. SPORTS1.1 related parameters if you download recommended reference database:
```
-g /<your_defined_address>/Glycine_max/Ensembl/Gm01/Sequence/BowtieIndex/genome
-m /<your_defined_address>/Glycine_max/miRBase_21/miRBase_21-gma
-r /<your_defined_address>/Glycine_max/rRNA_db/soybean_rRNA
-t /<your_defined_address>/Glycine_max/GtRNAdb/glyMax2-tRNAs
-f /<your_defined_address>/Glycine_max/Rfam_12.3/Rfam-12.3-soybean
```

Escherichia coli (E.coli)

annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0645cc2a0024d41fdba5be31a17bd5374&authkey=AaR4ui2QEXqh2-SpOIxaUik)

SPORTS1.1 related parameters if you download recommended reference database:

-g /<your_defined_address>/Escherichia_coli/Ensembl/EB1/Sequence/BowtieIndex/genome
-r /<your_defined_address>/Escherichia_coli/rRNA_db/e_coli_rRNA
-t /<your_defined_address>/Escherichia_coli/GtRNAdb/eschColi-tRNAs
-e /<your_defined_address>/Escherichia_coli/Ensembl/Escherichia_coli.HUSEC2011CHR1.ncrna
-f /<your_defined_address>/Escherichia_coli/Rfam_12.3/Rfam-12.3-e_coli

Instruction for compiling annotation database by user

Prepare the reference databases for your species X
1. Download the reference genome in .fa format into the defined folder address: <your_defined_address>; (necessary)
2. Download and extract the miRNA sequences belong to the species in .fa format from miRBase (http://www.mirbase.org/), convert RNA sequences to cDNA sequences (U -> T), then put the file X_mirbase.fa into the defined folder address: <your_defined_address>; (optional)
3. Download the rRNA sequences in .fa format from NCBI or anywhere else, convert RNA sequences to cDNA sequences (U -> T), name and list each rRNA sequences separately, as exampled below, and put the files such X_rRNA_5S.fa, X_rRNA_5.8S.fa into the defined folder address: <your_defined_address>; (optional)
human_rRNA_5S.fa
```
>Human 5S ribosomal RNA
GTCTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATCTCGGAAGCTAAGCAGGGTCGGGCCTG
GTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTTT
```
human_rRNA_5.8S.fa
```
>Human 5.8S ribosomal RNA
CGACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCGCTAGCTGCGAGAATTAATG
TGAATTGCAGGACACATTGATCATCGACACTTCGAACGCACTTGCGGCCCCGGGTTCCTCCCGGGGCTAC
GCCTGTCTGAGCGTCGCTT
```
1. Download the high confidence tRNA sequences (X-tRNAs.fa) and high confidence mature tRNA sequences (X-mature-tRNAs.fa) in .fa format from GtRNAdb (http://gtrnadb.ucsc.edu/) and put the files X-mature-tRNAs.fa and X-tRNAs.fa into the defined folder address: <your_defined_address>; (optional)
2. Download mitocondrial tRNA sequences from mitotRNAdb (http://mttrna.bioinf.uni-leipzig.de/mtDataOutput/) in .fa format and reformat the file X_mito-tRNA.fa by using the scripts provided below and put the generated files X-mt_tRNA.fa and X-mt_tRNA_CCA.fa into the defined folder address: <your_defined_address>; (optional)
mt_tRNA_transfer.pl X_mito-tRNA.fa X-mt_tRNA
1. Download the noncoding RNA sequences in .fa format from Ensembl database (http://ensemblgenomes.org/) and put the file X_ensembl_ncrna.fa into the defined folder address: <your_defined_address>; (optional)
2. Download and extract the noncoding RNA sequences belong to the species in .fa format from Rfam database (https://rfam.xfam.org/) and put the file X_rfam.fa into the defined folder address: <your_defined_address>; (optional)
3. Download piRNA sequences in .fa format from piRNA databases and put the file X_piRNA.fa into the defined folder address: <your_defined_address>. (optional)
Type following command in terminal:

sports.pl -i /foo/bar/download_seq/ -p 4 -g <your_defined_address>/X -m <your_defined_address>/X_mirbase -r <your_defined_address>/X_rRNA -t <your_defined_address>/X-tRNAs -e <your_defined_address>/X__ensembl_ncrna -f <your_defined_address>/X_rfam_ncrna -w <your_defined_address>/X_piRNA -o /foo/bar/output/

References

Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10(3):R25. doi: 10.1186/gb-2009-10-3-r25.
Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnetjournal. 2011;17(1):3. doi: http://dx.doi.org/10.14806/ej.17.1.200.
Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, et al. Discovering microRNAs from deep sequencing data using miRDeep. Nat Biotechnol. 2008;26(4):407-15. doi: 10.1038/nbt1394.
Kozomara A, Griffiths-Jones S. miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic acids research. 2014;42(Database issue):D68-73. doi: 10.1093/nar/gkt1181.
Chan PP, Lowe TM. GtRNAdb 2.0: an expanded database of transfer RNA genes identified in complete and draft genomes. Nucleic acids research. 2016;44(D1):D184-9. doi: 10.1093/nar/gkv1309.
Jühling F, Mörl M, Hartmann RK, Sprinzl M, Stadler PF, Pütz J. tRNAdb 2009: compilation of tRNA sequences and tRNA genes. Nucleic acids research. 2009 Jan;37(Database issue):D159-62. doi: 10.1093/nar/gkn772.
Zhang P, Si X, Skogerbo G, Wang J, Cui D, Li Y, et al. piRBase: a web resource assisting piRNA functional study. Database (Oxford). 2014;2014:bau110. doi: 10.1093/database/bau110.
Sai Lakshmi S, Agrawal S. piRNABank: a web resource on classified and clustered Piwi-interacting RNAs. Nucleic acids research. 2008;36(Database issue):D173-7. doi: 10.1093/nar/gkm696.
Yates A, Akanni W, Amode MR, Barrell D, Billis K, Carvalho-Silva D, et al. Ensembl 2016. Nucleic acids research. 2016;44(D1):D710-6. doi: 10.1093/nar/gkv1157.
Nawrocki EP, Burge SW, Bateman A, Daub J, Eberhardt RY, Eddy SR, et al. Rfam 12.0: updates to the RNA families database. Nucleic acids research. 2015;43(Database issue):D130-7. doi: 10.1093/nar/gku1063.

Update history

1.1.1 - 03/10/2021

Now the parameters performed in the pipeline will be dislayed in the header of the output log;
Fixed some bugs in the previous version.

1.1.0 - 02/20/2020

The tsRNA annotation information has been refined to pre-tsRNA and mature-tsRNA based on updated tRNA database;
Annotation for Mitocondrial tRNAs (obtained from mitotRNAdb http://mttrna.bioinf.uni-leipzig.de/mtDataOutput/) and yRNAs (obtained from https://www.ncbi.nlm.nih.gov/) are now available. Pre-compiled databases for mouse and human have been updated (databases for other species will updated soon if applicable), please re-download the databases for better results;
The miRNA annotation process has been optimized to get more accurate results.
Bowtie index building process has been imbedded in sports.pl to reduce the size of pre-compiled database (the bowtie index will build when the user using SPORTS for the first time);
New parameter '-z' is added to make mismatch information statistics optional ('-M' > 0 is needed for the statistics).
Instruction for compiling annotation database by user is added.

1.0.5 - 09/25/2018

Changed annotation strategy to fit more species tRNA annotation in GtRNAdb.
Fixed some bugs in the previous version. Thanks Catrin Lloyd to figure one out!

1.0.4 - 03/25/2018

New function added: if '-M' > 0 applied in sports.pl, statistics of mismatch information will generated to predict potential nucleic acid modification loci;
The figure of tRNA mapping information will generated if tRNA database is defined;
A sample output with the parameter '-M 1' of dataset GSM2304822 (mouse sperm) is uploaded here.

1.0.3 - 01/27/2018

Changed the mapping order to make the mapping results more accurate according to the paper " Juan Pablo Tosar, Carlos Rovira, Alfonso Cayota. Non-coding RNA fragments account for the majority of annotated piRNAs expressed in somatic non-gonadal tissues. Communications Biology. 2018;1, Article number: 2. doi: 10.1038/s42003-017-0001-7 ".

1.0.2 - 01/22/2018

Fixed bugs to generate more accurate mature tRNA database.

1.0.1 - 01/13/2018

Fixed bugs that caused unexpected exit.
Optimized script to speed up tRNA annotation process.

Copyright and licensing information

SPORTS1.1 is available under the GNU General Public License version 3 (GPLv3).

Disclaimer

The SPORTS1.1 package is provided as is without any guarantees or warranty for correctness. The authors are not responsible for any damage or loss of any kind caused by the use or misuse of the scripts included in the software package. The authors are not under obligation to provide support, service, corrections, or upgrades to the package.

Contact information

Contact author: Junchao Shi

E-mail: [email protected]; [email protected]

sports1.1's People

Contributors

Stargazers

Watchers

Forkers

xflicsu hygine tw7649116 kc-lan conyel peiwenliu18 xjyx mywanuo standardgalactic chhiara bigfacebig finitenet xia-youmei jianguozhou3 liangdp1984 gladiofeng

sports1.1's Issues

CCA end annotation

Hi,
Thank you so much for answering my previous questions promptly.
I have another question about the CCA end annotation: does it only count reads with intact non-template CCA tails or count those with non-template C or CC tails as well? I couldn't tell from my result because I see only intact CCA tails.
Thank you very much!

Cannot get sports to work

I have tried running SPORTS several times and I cannot manage to get it to run.

I tried using just one file and one genome using:
sports.pl -i /mnt/d/covum/run1/fastq_run1_merged_sample/Merged_fastq/Sample1_merged.fastq -g /mnt/d/covum/genomes/genome/hg38/genome

However....

Output results

Hi, I am trying to run sports.pl, like the example use 3. But the only output I am getting is a file named run_this.sh that is empty and I am not getting any warnings or errors so I would like to know what is happening

mt-tRNA annotation file

Hi Junchao,

I have only one small question regarding the Human precompiled database you provided. I noticed that the file hg19-mt_tRNAs.fa contains 29 sequences, but when I searched mitotRNAdb, I only found 22 results. Could you please explain why there is a discrepancy? Additionally, I'm just wondering whether you have plans to provide a precompiled database for hg38 in the future?

Thank you for your help and expertise.

Best regards,
Arya

paired end small RNA-Seq?

Dear Shi,
if I have a paired end small RNA-Seq data, can I analysis it using SPORTS?

unmatch genome part

Hi Junchao,

I have a question here: when you map to rRNA_5S (your script below), you have two steps: match genome and unmatch genome. But the bowtie index for rRNA 5S for the two steps is the same one. I don't understand why you map the unmatch genome reads to rRNA 5S again.

For my understanding, when the reads can't map to human genome, it can't map to human small RNA databases either.

That would be awesome if you can explain this part to me. Thanks.

'''
name=rRNA_5S
bowtie_address=/storeData/project/user/daixiaozhuan/reference/SPORTS1.0_smallRNAdb/Homo_sapiens/rRNAdb/human_rRNA_5S

######match genome part
echo ""
echo "match to ${name}-match_genome"
output_match_match_genome=${output_address}${input_query_name}match${name}_match_genome.fa
output_unmatch_match_genome=${output_address}${input_query_name}unmatch${name}_match_genome.fa
touch ${output_match_match_genome}
touch ${output_unmatch_match_genome}

bowtie ${bowtie_address} -f ${input_match} -v ${mismatch} -a -p ${thread} --fullref --norc --al ${output_match_match_genome} --un ${output_unmatch_match_genome} >> ${output_detail_match_genome}

######unmatch genome part
echo ""
echo "match to ${name}-unmatch_genome"
output_match_unmatch_genome=${output_address}${input_query_name}match${name}_unmatch_genome.fa
output_unmatch_unmatch_genome=${output_address}${input_query_name}unmatch${name}_ummatch_genome.fa
touch ${output_match_unmatch_genome}
touch ${output_unmatch_unmatch_genome}

bowtie ${bowtie_address} -f ${input_unmatch} -v ${mismatch} -a -p ${thread} --fullref --norc --al ${output_match_unmatch_genome} --un ${output_unmatch_unmatch_genome} >> ${output_detail_unmatch_genome}
'''

not mature-tRNA but pre-tRNA

Hi, I would like to consult why the results is not contain match pre-tRNA information
the operation is here :
sports.pl -i /etc/SRR/245out.fastq -p 4 -g /etc/SRR/UCSC/rn6/Sequence/BowtieIndex/genome -t /etc/SRR/GtRNAdb/rn5-tRNAs -M 1 -o /etc/SRR/output/
Thank you for you attention
Best wishes!

Error in locating indexes

Hi Junchao,
I am using sports1.1 to analyse sRNAseq data. I installed as you told. The programs bowtie(1.2.1.1) and sports.pl seem to be functioning properly. However, when I ran SPORT1.1 with my cleaned out data, I got “ Could not locate a Bowtie index corresponding to basename "Homo_sapiens/genome/hg38/genome" ” in the processing report.

I tried with these parameters:
nohup time sports.pl -i test.fq -p 8 -g Homo_sapiens/genome/hg38/genome -m /Homo_sapiens/miRBase/21/miRBase_21-has -r Homo_sapiens/rRNAdb/human_rRNA -t Homo_sapiens/GtRNAdb/hg19/hg19-tRNAs -w Homo_sapiens/piRBase/piR_human -o output_test/ -k > log_test 2>&1

And I got these in log:

The processing report shows:

When I checked the Homo_sapiens file, I saw that indexes (.ebwt files) have been output.

After the issue occurred, I tried reinstalling SPORTS1.1 and the corresponding software, and also re-downloading the pre-compiled database. In addition, I used the bowtie software to directly build indexes and then ran sports.pl. But it seems that these didn't work out. The latest result is still the same problem.

I'm not sure which part is wrong? And How can I deal with this issue? Hope you answer soon.

Thanks!
Arya

tsRNA annotation results

Hi,
Thanks for your wonderful work. It's very convenient to use sports1.1 to annotate smallRNAseq data. Once I got the results, I have a questions here:

For tsRNA results, I saw three types: *_5_end, *_3_end and *_CCA_end, what's the difference between 3_end and CCA_end?
Also, some tRNAs don't belongs to these three types, for example "tRNA-Val-AAC", which catergorize to none of these three; So how should I deal with this situation if I wanna analysis tsRNAs in my samples?

Looking forward for your reply!
Thanks,
Xiaozhuan

differential analysis

Hi,

Thanks in advance for this github project.

The sports1.1 is really nice for small-RNA-Seq data analysis, especially its updated version from 1.0 to 1.1.

I ran the pipeline successfully and the next step is to do differential analysis.

But I'm puzzled that the results are assigned by a single sample, like the quantitative result data comprising Sequence and Reads.
while my sample group is 3V3, how to merge the samples to a combined data, can i use the Sequence as the reference between samples?

And the following differential analysis step, can i use R package DESeq2 or other recommend packages?

Thanks again and looking forward to your reply!

Best,

Haifeng Sun
Nanjing Medical University, China
2022-09-29

sports output

Hi,
Have a question about one of the output file xxx_summary.txt: why the read numbers are not integer in this case? are these normalized read counts? e.g. the following is an example of the result I got:

1_S1_1/ncRNA-Run3-Sample1_S1_1_result$ more ncRNA-Run3-Sample1_S1_1_summary.txt

Class Sub_Class Reads
Clean_Reads - 639656
Match_Genome - 205787
miRBase-miRNA_Match_Genome - 1740
miRBase-miRNA_Match_Genome mmu-let-7a-1 10.50
miRBase-miRNA_Match_Genome mmu-let-7a-2 8.50
miRBase-miRNA_Match_Genome mmu-let-7b 4.00
miRBase-miRNA_Match_Genome mmu-let-7c-1 2.50
miRBase-miRNA_Match_Genome mmu-let-7c-2 3.50

Thank you very much for your help in advance

Generate RNA length distribution per treatment

Hi @junchaoshi,

I'm trying to get a figure like the one generated in overall_RNA_length_distribution.R showing that same histogram but instead of individual samples I want to show samples of a specific treatment. In my experiment I have 2 treatments with 4 samples each. I was wondering what could be the best approach. Since the script computes the RPM values using the counts for the plot, I was thinking about leveraging that to get the RPM values for the individual samples and computing a mean for each of the groups. Do you think this is the right approach to quantify the abundance per treatment? Or would it be better to just merge (by averaging the raw counts, for example) the respective samples and rerun the whole SPORTS pipeline?

Best regards,

rRNA output systematically emtpy

Hi,
Thanks for the great tool.
I'm using your Mus Musculus annotation (and -r $ref/rRNA_db/mouse_rRNA) with standard truseq small rna data, and there's never any overlap detected with rRNA_db annotation: the _processed/*_output_rRNA_* are empty (but there), and in the _result/*_summary.txt file there are (many) reads assigned to ensembl-rRNA and Rfam-rRNA, but nothing from rRNA_db. The processing_report/*.txt is empty in that section, and has no other indication except plotting errors at the end, i.e.:

match to rRNA database

match to tRNA database

[...]

generating graph
Error: No enough input parameters!
Execution halted
Error: No enough input parameters!
Execution halted

It seems difficult to imagine that there would really be no trace of the 4S/5S/etc (across many samples)...
Looking at the different annotation subfolders, I noticed that while all annotations have a single bowtie index (i.e. prefix), rRNA_db has several - could the problem stem from this?

Any pointer on how to debug this would be appreciated.

summary file

Hi Junchao,

I want to generate the ratio of different RNA types. Firstly, I extracted the information directly from the file "*.mapped.sorted.txt" in the "processing_report" folder. But I check the reads number is not correct. Then I checked the summary file as below, why the Match_Genome number is larger than the Clean_Reads? Do you have any advice on which file should I use the output the summary?

Thanks,
Xiaozhuan

rRNA_length_distribution.R Error: No enough input parameters!

There are only 2 parameters (file.address and file.name) in the rRNA_length_distribution.R README example, but rRNA_length_distribution.R asks for another rRNA.length parameter provided.

Understanding the pre-compiled databases

Hi,

I am trying to understand how the pre-compiled databases were obtained.

-rRNA database (Original source: https://www.ncbi.nlm.nih.gov/nuccore)

I am not sure how exactly rRNAs were obtained. Does one just have to search for the species and take all the fasta sequences?

-mitotRNAdb database [6] (Original source: http://mttrna.bioinf.uni-leipzig.de/mtDataOutput/)

It looks like there are only 22 mt_tRNAs for mouse: http://mttrna.bioinf.uni-leipzig.de/mtDataOutput/Result

Whereas, there are 45 in the pre-compiled ones.

Thank you for clarifying.

tRNA annotation

Hi,
Thanks so much for answering my previous questions.
Another question regarding tRNA annotation. What's the criteria for annotating a read as a 3' or 5' end tRNA?

Thanks

About new tsRNA

Hi,
if the sequence have maped to the genome and maped to the GtRNAdb,but the sequence can not find in tsRNA database like tsRbase :"http://www.tsrbase.org/",tRFdb:"http://genome.bioch.virginia.edu/trfdb/statistics.php".Can we consider it a new tsRNA?
Thank you for you attention.

Best

Problem in running annotation.pl

Hi Sports team!

Thanks for making this pipeline and I am trying to run the annotation.pl but faced the error with the incorrect file path.

The error is below

 $ sports.pl -i 1_trim_out/1_0262_X1_18_S18_R1_001_trimmed.fastq -p 20 -k -z -M 2 
  -g /home/wkq953/scop/SCOP_2024_0262/pipeline-out/foo/bar/Homo_sapiens/genome/hg38/genome 
  -m /home/wkq953/scop/SCOP_2024_0262/pipeline-out/foo/bar/Homo_sapiens/miRBase/21/miRBase_21-hsa 
  -o /home/wkq953/scop/SCOP_2024_0262/pipeline-out/test/

  $ annotation.pl test/
Can't open 'test/.fa': No such file or directory at /maps/projects/scop/apps/sports1.1-master/source/annotation.pl line 55.

 $ annotation.pl test/1_0262_X1_18_S18_R1_001_trimmed/
Can't open 'test/1_0262_X1_18_S18_R1_001_trimmed/.fa': No such file or directory at /maps/projects/scop/apps/sports1.1-master/source/annotation.pl line 55.

$ annotation.pl test/1_0262_X1_18_S18_R1_001_trimmed/0262_X1_18_S18_R1_001_trimmed_fa/
Can't open 'test/1_0262_X1_18_S18_R1_001_trimmed/0262_X1_18_S18_R1_001_trimmed_fa/.fa': No such file or directory at /maps/projects/scop/apps/sports1.1-master/source/annotation.pl line 55.

$ annotation.pl test/1_0262_X1_18_S18_R1_001_trimmed/0262_X1_18_S18_R1_001_trimmed_fa/0262_X1_18_S18_R1_001_trimmed_match_genome
readline() on closed filehandle $file_handle{...} at /maps/projects/scop/apps/sports1.1-master/source/annotation.pl line 120.

And the output folder looks like

$ ll test/
total 144
1_0262_X1_18_S18_R1_001_trimmed
processing_report
run_this.sh
sh_file

Thanks for your help!

question about annotation.pl

Hi Junchao,
I am ran the sports.pl and produce the results. But when I run the annotation.pl, I meet the wrong:

Can't open '/smallrna/qi/out.fa': No such file or directory at annotation.pl line 33.

my sports.pl file is in the "/smallrna/qi/",named "out". The "out" file contain "1_S1_trimmed","processing_report","sh_file" and "run_this.sh"

I am looking forward to your reply!

Best wishes!
heming wang

can we merge the similar sequences when processing the smallRNA data

Hi, Junchao,

I got the results from sports1.1, some similar sequences like:

AAAAAACATTAGACTGTGAATCTGACAACAGGAAATAAACCTCCT 42 30 232 53 296 24 46 104 197 229
AAAAAACATTAGACTGTGAATCTGACAACAGGAAATAAACCTCC 16 9 63 22 120 12 16 20 48 30
AAAAAACATTAGACTGTGAATCTGACAACAGGAAATAAACCTC 29 3 41 22 47 7 4 0 21 21

and my supervisor hope that I can merge such three sequence to one so that perfrom following differential analysis.

I don't know whether it's suitable here for smallRNA data process and I didn't find literatures with such a description.

Can you give me some ideas or suggestions?

Thank you very much in advance!

Best,
Haifeng Sun

Ph.D. candidata student from Nanjing Medical University, China

No output

Dear sir,
When I used the sports1.1, there is no error but I don't know have no output.
Please give me some advice, thank you very much.

Best wishes,
Crane

$./source/sports.pl -i Sperm.txt -p 4 -a -x GTTCAGAGTTCTACAGTCCGACGATC -y TGGAATTCTCGGGTGCCAAGG -g ./Mus_musculus/genome/mm10/genome -m ./Mus_musculus/miRBase/21/miRBase_21-mmu -r ./Mus_musculus/rRNAdb/mouse_rRNA -t ./Mus_musculus/GtRNAdb/mm10/mm10-tRNAs -w ./Mus_musculus/piRBase/piR_mouse -e ./Mus_musculus/Ensembl/release-89/Mus_musculus.GRCm38.ncrna -f ./Mus_musculus/Rfam/12.3/Rfam-12.3-mouse -o ../Reads/output -k

SPORTS version: 1.1.1

Citation: Junchao Shi, Eun-A Ko, Kenton M. Sanders, Qi Chen, Tong Zhou. “SPORTS1.0: a tool for annotating and profiling non-coding RNAs optimized for rRNA-and tRNA-derived small RNAs.” Genomics, Proteomics & Bioinformatics (2018) doi.org/10.1016/j.gpb.2018.04.004.

Input file address: /media/EXTend2018/Wanghe2019/zahuo/tsRNA/sports1.1-master/Sperm.txt
output file address: ../Reads/output
Reference genome address: ./Mus_musculus/genome/mm10/genome
Reference miRNA database address: ./Mus_musculus/miRBase/21/miRBase_21-mmu
Reference tRNA database address: ./Mus_musculus/GtRNAdb/mm10/mm10-tRNAs
Reference rRNA database address: ./Mus_musculus/rRNAdb/mouse_rRNA
Reference piRNA database address: ./Mus_musculus/piRBase/piR_mouse
Reference ensembl ncRNA database address: ./Mus_musculus/Ensembl/release-89/Mus_musculus.GRCm38.ncrna
Reference rfam ncRNA database address: ./Mus_musculus/Rfam/12.3/Rfam-12.3-mouse
Trimming 5' adapter: GTTCAGAGTTCTACAGTCCGACGATC
Trimming 3' adapter: TGGAATTCTCGGGTGCCAAGG
Filtering min lenth: 15
Filtering max lenth: 45
Mapping mismatch tolerance: 0
Debugging mode ON: keep all the intermediate files generated during the running progress
Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, <FILE_IN> line 1.
Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, <FILE_IN> line 1.
Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, <FILE_IN> line 2.
Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, <FILE_IN> line 2.
Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, <FILE_IN> line 3.
Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, <FILE_IN> line 3.
Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, <FILE_IN> line 4.
Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, <FILE_IN> line 4.
Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, <FILE_IN> line 5.
Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, <FILE_IN> line 5.
Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, <FILE_IN> line 6.
Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, <FILE_IN> line 6.

Processing input files...

Done!

Human annotation files

Is there already a precompiled database for hg38?

The existing link provided contains both hg19 and hg38 and it is hard to know if all are from hg38.

Processing report

Hi,
I am trying to interpret the processing report generated by Sports1.1.
After cutadapt, the first step is to match all reads from cutadapt to the genome, right? so the number we see here is the amount of reads left from cutadapt?
In the following example I have, is it right that after adapter trimming, there are 32432 reads left from 1,224,009 starting reads in the fastq file?
After that, the reads are divided to map to different libraries accordingly. Is that right?

remove 5' adapter
This is cutadapt 2.3 with Python 3.6.9
......

=== Summary ===

Total reads processed: 1,224,009
Reads with adapters: 1,022,193 (83.5%)
Reads with too many N: 0 (0.0%)
Reads written (passing filters): 1,224,009 (100.0%)

Total basepairs processed: 83,232,612 bp
Total written (filtered): 31,674,723 bp (38.1%)

=== Adapter 1 ===

Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 5'; Length: 34; Trimmed: 1022193 times.

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3
Overview of removed sequences
length count expect max.err error counts
3 2258 19125.1 0 2258
4 205 4781.3 0 205
.....
68 33556 0.0 3 6860 10078 9085 7533
match to genome
reads processed: 32432
reads with at least one reported alignment: 332 (1.02%)
reads that failed to align: 32100 (98.98%)
Reported 332 alignments

Thank you so much for your help in advance

Bowtie problem

Dear shi,when i can not match to index of bowtie-build，although I already have these index file.The error is that:

match to miRNA-match_genome
Could not locate a Bowtie index corresponding to basename "Arabidopsis_thaliana/miRBase_21/miRBase_21-ath"
Command: bowtie --wrapper basic-0 -f -v 0 -a -p 1 --fullref --norc --al /home/cuimingyang/sports-sRNA/text/1_S1_1_trimmed/S1_1_trimmed_match_miRNA_match_genome.fa --un /home/cuimingyang/sports-sRNA/text/1_S1_1_trimmed/S1_1_trimmed_unmatch_miRNA_match_genome.fa Arabidopsis_thaliana/miRBase_21/miRBase_21-ath /home/cuimingyang/sports-sRNA/text/1_S1_1_trimmed/S1_1_trimmed_match_genome.fa

Overlapping between different annotation?

Hi,

Thank you so much for prompt reply to my previous questions. Really appreciate it.
I have more questions about interpreting the output from sports:

Is there overlapping between different classes? for example in output xxx.summary.txt, I saw the following classes for tRNA. Are reads counted in tRNA_5_end (and other ends) also counted in the tRNA_Match_Genome class?
The output pdf files shows the percentage of each type of tRNA in a pie chart, how the tRNA percentage is calculated? (5-end, 3-end, and CCA-end divided by the tRNA_match_genome plus tRNA_unmatch_genome? are mitotRNA also included in the calculation?

Thank you so much for your help!

--------- following is the classes in the summary.txt file in my case---

GtRNAdb-mature-tRNA_Match_Genome
GtRNAdb-mature-tRNA_5_end_Match_Genome
GtRNAdb-mature-tRNA_3_end_Match_Genome
GtRNAdb-mature-tRNA_CCA_end_Match_Genome
GtRNAdb-mature-tRNA_Unmatch_Genome
GtRNAdb-mature-tRNA_CCA_end_Unmatch_Genome
mitotRNAdb-mature-mt_tRNA_Match_Genome
mitotRNAdb-mature-mt_tRNA_3_end_Match_Genome
mitotRNAdb-mature-mt_tRNA_CCA_end_Match_Genome
mitotRNAdb-mature-mt_tRNA_Unmatch_Genome
mitotRNAdb-mature-mt_tRNA_CCA_end_Unmatch_Genome

Adding G to tRNA Histidine

Hi,

I got another question about the tRNA Histidine. https://github.com/junchaoshi/sports1.1#trna_db_processingpl

You mentioned that a G is added to the 5' of the sequence.

If I check the sequences, a G is already present at the start of the sequence: http://gtrnadb.ucsc.edu/genomes/eukaryota/Mmusc10/mm10-tRNAs.fa

So, I guess, you are adding a G only if the sequence does not start with G. Is this correct?

Also, is there any reference for this?

Thank you in advance for clarifying.

Compiling annotation database by user

Hi Junchao,

I would like to know what's different of the Rfam ncRNA db between ensemblgenomes and Rfam database in the section of "Instruction for compiling annotation database by user" ? Which one should we follow? X_rfam_ncrna.fa or X_rfam.fa? Shall we just choice one for the ncRNA from rfam db?

Download and extract the noncoding RNA sequences in .fa format from Rfam database (http://ensemblgenomes.org/) and put the file X_rfam_ncrna.fa into the defined folder address: <your_defined_address>; (optional)

Download and extract the noncoding RNA sequences belong to the species in .fa format from Rfam database (https://rfam.xfam.org/) and put the file X_rfam.fa into the defined folder address: <your_defined_address>; (optional)

Thank you for your help.

Cheers,
Louis

Should the file generated by tRNA_db_processing.pl be used for generating bowtie indexes?

Hello,

Thank you for developing the tool. I used the provided Mus musculus pre-compiled databases files and I realized they are not the latest release. I want to use the updated files and for that I manually downloaded the mm39-tRNA fasta file. I then saw that you provide a script tRNA_db_processing.pl that adds CCA to 3'end and G to 5'end of Histidine. However, I saw that in the recommended command line you don't indicate the name of the tRNA_CCA index files, even though the bowtie index files are included in the mm10 pre-compiled database:

sports.pl [...] -t /foo/bar/Mus_musculus/GtRNAdb/mm10/mm10-tRNAs
Instead of:
sports.pl [...] -t /foo/bar/Mus_musculus/GtRNAdb/mm10/mm10-tRNAs_CCA

I wonder what to use with the updated files that I downloaded. Should I pass the *_CCA indexes to sports.pl ?

Thanks,

Sergio

Summaries don't sumup

I was checking some resulted summaries and while I was trying to find the sum up of "matched to genome reads" were correct and I found that it is different than the one it is typed in the "summary.txt".
Could you have a look on that?
random2_summary.txt
random1_summary.txt

These files have been produced from original summaries files using grep for only the "Match_Genome" entries

Version of reference

Hi Junchaoshi,

Thank you very much for creating such wonderful tool! Would it be possible to update the version of genome, Rfam, miRBase and GtRNAdb? Besides, would it be possible to clarify the format criteria of different reference. That will be very helpful for people to apply sports to their unannotated ncRNA or new species.

Thanks again for your excellent tool!

Best,
Louis

No results in mapped to any database

Hi !

I am running sports1.1 with the following command:

DIR=/media/sergio/HDD1/smallrna
sports.pl -i sports_pipeline/seq_address.txt -p 8 -g $DIR/features/SPORTS_db/Mus_musculus/genome/mm10/genome -m $DIR/features/SPORTS_db/Mus_musculus/miRBase/21/miRBase_21-mmu -r $DIR/features/SPORTS_db/Mus_musculus/rRNAdb/mouse_rRNA -t $DIR/features/SPORTS_db/Mus_musculus/GtRNAdb/mm10/mm10-tRNAs -w $DIR/features/SPORTS_db/Mus_musculus/piRBase/piR_mouse -e $DIR/features/SPORTS_db/Mus_musculus/Ensembl/release-89/Mus_musculus.GRCm38.ncrna -f $DIR/features/SPORTS_db/Mus_musculus/Rfam/12.3/Rfam-12.3-mouse -o sports_pipeline/output/ -k

Not that I'm ruinning Bowtie version 1.3.1 and I used Trimgalore to trim the read adapters.

Processed files are run very fasta and the processing report for every sample look like this, with no alignments in any database:

I guess that the message about the index comes from the more recent version of Bowtie. However I do not know where the "rm" error comes from. My "seq_address.txt" file looks like this:

Thank you in advance!
Sergio

perl file not working

whenever I run the perl script sports.pl I get the same issue. What is going on?

no annotaion file output

Hi Junchao,
I used this command line to annotate small RNA(input file is fastq format):
sports.pl -i seq_address.txt -p 4 -g /BIGDATA2/sysu_hshwang_1/soft/database/Homo_sapiens/genome/hg38/genome
-m /BIGDATA2/sysu_hshwang_1/soft/database/Homo_sapiens/miRBase/21/miRBase_21-hsa
-r /BIGDATA2/sysu_hshwang_1/soft/database/Homo_sapiens/rRNAdb/human_rRNA
-t /BIGDATA2/sysu_hshwang_1/soft/database/Homo_sapiens/GtRNAdb/hg19/hg19-tRNAs
-w /BIGDATA2/sysu_hshwang_1/soft/database/Homo_sapiens/piRBase/piR_human
-e /BIGDATA2/sysu_hshwang_1/soft/database/Homo_sapiens/Ensembl/release-89/Homo_sapiens.GRCh38.ncrna
-f /BIGDATA2/sysu_hshwang_1/soft/database/Homo_sapiens/Rfam/12.3/Rfam-12.3-human
-o /BIGDATA2/sysu_hshwang_1/sports/output
the output file is follow:

There is no error in the log file:

Change the order of Databases

Dear Junchaoshi,
Thanks for this great software tool, I would like to know if there is a possibility to change the order of
databases annotation.
I would like to annotate piRNAdb after miRNA if it is possible.
I'm aware of the publication

Non-coding RNA fragments account for the majority of annotated piRNAs expressed in somatic non-gonadal tissues

but I would like to have the option for that.

match genome 0

Dear Shi,

I would like to use sports1.1 to analyse a smallRNAseq dataset, but I'm finding some issues with it. I installed it following the installation recipe and all the programs seem to be functioning. However, when I run SPORT1.1 I got:

Class Sub_Class Reads
Clean_Reads - 3321509
Match_Genome - 0
Unannotated_Match_Genome - 0
Unannotated_Unmatch_Genome - 3321509

So, bowtie is not mapping any read. I have tried using bowtie2 with the same datasets and they are properly mapped. As I can see the issue is not from SPORTS1.1 but with bowtie. I'm using your pre-build database.

Checking the processing report file, I can see this Error reading _rstarts[] array: 7376, 14208 but I don't find this error in google.

match to genome
Error reading _rstarts[] array: 7376, 14208
Command: bowtie-align --wrapper basic-0 -f -v 0 -k 1 -p 8 --al /rds/project/rds-XUr6B1Jhndg/ah2192_backup/projects/small_rna_seq/data/small_RNAseq_NHS_HS/SPORTS1.1_output/1_S463_A1_R1_val_1/S463_A1_R1_val_1_match_genome.fa --un /rds/project/rds-XUr6B1Jhndg/ah2192_backup/projects/small_rna_seq/data/small_RNAseq_NHS_HS/SPORTS1.1_output/1_S463_A1_R1_val_1/S463_A1_R1_val_1_unmatch_genome.fa /home/ah2192/rds/rds-mrc_tox-XUr6B1Jhndg/ah2192_backup/annotations/smallRNA/Homo_sapiens/genome/hg38/genome /rds/project/rds-XUr6B1Jhndg/ah2192_backup/projects/small_rna_seq/data/small_RNAseq_NHS_HS/SPORTS1.1_output/1_S463_A1_R1_val_1/S463_A1_R1_val_1.fa
rm: cannot remove ‘/rds/project/rds-XUr6B1Jhndg/ah2192_backup/projects/small_rna_seq/data/small_RNAseq_NHS_HS/SPORTS1.1_output/1_S463_A1_R1_val_1/S463_A1_R1_val_1_processed/S463_A1_R1_val_1_output_tRNA’: No such file or directory
rm: cannot remove ‘/rds/project/rds-XUr6B1Jhndg/ah2192_backup/projects/small_rna_seq/data/small_RNAseq_NHS_HS/SPORTS1.1_output/1_S463_A1_R1_val_1/S463_A1_R1_val_1_processed/S463_A1_R1_val_1_tRNA_mapping.txt’: No such file or directory

Any input it more than welcome!
Thanks,
Andres

add new RNA type

Hi,
thanks for your wonderful work. But if I want to add other types of ncRNA database into sports, for example snoRNA, vault RNA etc. How can I do it?

Thanks

how to add MT-tRNA sequence into GtRNAdb

Hi:
Thanks very much for your work, Sports1.0 is very nice and useful.
My species genome is mm10, and I think some tsRNAs are derived from tRNA. But when I add the MT-tRNA sequence into mm10-tRNAs.fa like this:

Mus_musculus_tRNA-MTSer-TGA-1-1
GAGAAAGACATATAGGATATGAGATTGGCTTGAAACCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTA
Mus_musculus_tRNA-MTThr-TGT-1-1
GTCTTGATAGTATAAACATTACTCTGGTCTTGTAAACCTGAAATGAAGATCTTCTCTTCTCAAGACA

and then run sports.pl. The result is like:

t00000651 TCCCTGGTGGTCTAGTGGTTAGGATTCGGC 30 2 Yes tRNA-Glu-CTC_5_end;tRNA--_5_end
t00000769 AAGAAAGATTGCAAGAACTG 20 2 Yes tRNA--_5_end
t00001268 GCATTGGTGGTTCAGTGGTAGAATTCTCGCCT 32 2 Yes tRNA-Gly-GCC_5_end;tRNA-Gly-CCC_5_end

which is not my expectation. I dont know how to solve this problem. Can you give me some advices?

Thank you in andvance for any help!
Best wishes

Haifeng Sun
2020.01.10

Output folder

Hi!
I started the analysis twice using the code below. The analysis was completed without any problems the first time. On my second try, I changed the files in seq_address.txt and ran it again, but I got the following error.
"Command: bowtie-build --wrapper basic-0 --threads 24 -q /home/yildize/sports/Mus_musculus/genome/mm10/genome.fa /home/yildize/sports/Mus_musculus/genome/mm10/genome
mv: cannot stat '/home/yildize/sports/output/sh_file/.sh': No such file or directory
rmdir: failed to remove '/home/yildize/sports/output/sh_file': No such file or directory
rm: cannot remove '/home/yildize/sports/output/.sh': No such file or directory"
The code I used in both analyzes is;"sports.pl -i seq_address.txt -p 24 -g /home/yildize/sports/Mus_musculus/genome/mm10/genome -m /home/yildize/sports/Mus_musculus/miRBase/21/miRBase_21-mmu -r /home/yildize/sports/Mus_musculus/rRNAdb/mouse_rRNA -t /home/yildize/sports/Mus_musculus/GtRNAdb/mm10/mm10-tRNAs -w /home/yildize/sports/Mus_musculus/piRBase/piR_mouse -f /home/yildize/sports/Mus_musculus/Rfam/12.3/Rfam-12.3-mouse -o /home/yildize/sports/untroutput/"
Thank you in advance for your time.

Error in running sports.pl

Hi,

I tried running sports with these parameters:
sports.pl -i files.txt -m /media/nsg/Data/Genome-assemblies/Rat/sports/Rattus_norvegicus/miRBase_21/miRBase_21-rno -r /media/nsg/Data/Genome-assemblies/Rat/sports/Rattus_norvegicus/rRNAdb/rat_rRNA -t /media/nsg/Data/Genome-assemblies/Rat/sports/Rattus_norvegicus/GtRNAdb/rn5-tRNAs -w /media/nsg/Data/Genome-assemblies/Rat/sports/Rattus_norvegicus/piRBase/piR_rat -f /media/nsg/Data/Genome-assemblies/Rat/sports/Rattus_norvegicus/Rfam_12.3/Rfam-12.3-rat -e /media/nsg/Data/Genome-assemblies/Rat/sports/Rattus_norvegicus/Ensembl/Rattus_norvegicus.Rnor_6.0.ncrna -g /media/nsg/Data/Genome-assemblies/Rat/sports/Rattus_norvegicus/UCSC/rn6/Sequence/BowtieIndex/genome -p 4 -o ./output

However I got this error message:
Filtering min lenth: 15
Filtering max lenth: 45
Mapping mismatch tolerance: 0
Use of uninitialized value $tmp in -d at /home/nsg/sports1.1-master/source/sports.pl line 352, <FILE_IN> line 1.
Use of uninitialized value $tmp in -f at /home/nsg/sports1.1-master/source/sports.pl line 387, <FILE_IN> line 1.
can not open '/media/nsg/Data/Sherif/Gtpbps small RNA seq/sports/output/sh_file/1_Gtpbp2.sh' at /home/nsg/sports1.1-master/source/sports.pl line 479, <FILE_IN> line 4.

Can you please help me figure out what`s the issue?
Thanks!

pirna annotation

Hi there,

The final output of all piRNAs are labeled the same as "piRNA". Is there a way to include the piRNA id?

tsRNA annotation

Hi, thank you for you work in small RNA research , I would like to consult if the outcome from summary like tRNA_5_end and tRNA_3_end equal to the tsRNA?If equivalent ,then whether there tsRNAs have a uniform nomenclature.
Thank you for you attention.

Recommend Projects

React

A declarative, efficient, and flexible JavaScript library for building user interfaces.
Vue.js

🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
Typescript

TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
TensorFlow

An Open Source Machine Learning Framework for Everyone
Django

The Web framework for perfectionists with deadlines.
Laravel

A PHP framework for web artisans
D3

Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

javascript

JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
web

Some thing interesting about web. New door for the world.
server

A server is a program made to process requests and deliver data to clients.
Machine learning

Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Visualization

Some thing interesting about visualization, use data art
Game

Some thing interesting about game, make everyone happy.

Recommend Org

Facebook

We are working to build community through open source technology. NB: members must have two-factor auth.
Microsoft

Open source projects and samples from Microsoft.
Google

Google ❤️ Open Source for everyone.
Alibaba

Alibaba Open Source for everyone
D3

Data-Driven Documents codes.
Tencent

China tencent open source team.