Coder Social home page Coder Social logo

Comments (2)

jdidion avatar jdidion commented on July 22, 2024

After setting the minimum score low enough, I finally get an alignment:

SRR3106538.397648993 83 chrM 303 255 57S8M1I85M = 15 -438 GTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCCCCCAACCCCCCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCA +++$+?$?$???+++?++?$++?+++?+++++?+++??????????+??+?+??????????????????????????????????????????????????????????????????????????????????????????????????? AS:i:-58 ZS:i:-66 XN:i:0 XM:i:0 XO:i:1 XG:i:1 NM:i:1 MD:Z:93 YS:i:-6 YT:Z:CP NH:i:1
SRR3106538.397648993 163 chrM 15 255 151M = 303 438 CACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCCCATCCTATTATTTATCGCA ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????+????+???++?+???+???++?+?++++???# AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:131T19 YS:i:-58 YT:Z:CP NH:i:1

However, strangely, HISAT2 is choosing to soft-clip 57 bp so as to only open a 1 bp gap, rather than preferring the better overall alignment with a 6 bp gap. For reference, here is BWA MEM's alignment:

SRR3106538.397648993 163 chrM 15 60 151M = 251 381 CACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCCCATCCTATTATTTATCGCA ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????+????+???++?+???+???++?+?++++???# NM:i:1 MD:Z:131T19 AS:i:146 XS:i:83
SRR3106538.397648993 83 chrM 251 60 59M6I86M = 15 -381 GTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCCCCCAACCCCCCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCA +++$+?$?$???+++?++?$++?+++?+++++?+++??????????+??+?+??????????????????????????????????????????????????????????????????????????????????????????????????? NM:i:10 MD:Z:12A33A2A9T85 AS:i:113 XS:i:45

Maybe this is due to the fact that BWA MEM performs local realignment? Is that something HISAT2 does, or that is planned for the future?

from hisat2.

infphilo avatar infphilo commented on July 22, 2024

Thank you for reporting this issue, and sorry for taking this long time to get back to you (I've been swamped). HISAT2 previously allowed insertions and deletions up to 3 bps long. I changed it to allow indels of arbitrary length as long as the alignment score is above or equal to the minimum alignment score. The fix is available in the master branch if you'd like to give it a try. I'll try to release a new version of HISAT2 in a couple of weeks.

For your read, the new implementation has the following alignment:

0 0 MT 251 255 52M5I8M1I85M * 0 0 GTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCCCCCAACCCCCCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-46 XN:i:0 XM:i:3 XO:i:2 XG:i:6 NM:i:9 MD:Z:12A33A2A95 YT:Z:UU NH:i:1

from hisat2.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.