Comments (7)
Note searching the original file for illicit characters does not return anything..
grep -v '^>' GCF_011100685.1_UU_Cfam_GSD_1.0_genomic.fna.masked | grep -o '[^ATCGactgNn]'
from cactus.
That's a new one. Given the error says (greater than sign ">")
perhaps it's an empty sequence names that's triggering it? Cactus does its own check for non-agctn characters well upstream of this, so it's likely something less simple.
You should be able to confirm by creating a work directory (I'm using ./work
below) and rerunning the failing command with these flags added:
--restart --caching false --cleanWorkDir never --workDir ./work
then pull the relevant fasta files being input into lastz
out of find ./work
and inspect them yourself.
from cactus.
yup so there are some issues with some of the fasta files - but not empty headers.
1st lines of one of the offending fasta files (which I wrapped to make parsing easier) - looks good here.
Line 1: >id=GCF_009873245.2_mBalMus1.pri.v3|NC_045787.1|171266408|90000000
Line 2: ctttaatccattttgagtttatttttgtgtgtggtgttaggaagtgttctaatttcattcttttacatgtagctgtccagttttcccagcaccacttatt
Line 3: gaagaggctgtcttttctccactgtatattcttgcctcctttgtcaaagataaggtgaccatatctgcgtgggtttatctctgggctttctatcctgttc
Somewhere in the middle of the file a newline character was missed for a 2nd fasta entry.
Line 783808: attgacacgtggcactgaacccagagtggcaagtcttccccgtttcccagagaacccacaattccccgtcctatgtgaaatcccccaagttttaaatacc
Line 783810: GACATTATAGATACATTTGATAATTAAAAGGAATAGTACGTATTCCAGCTAGGAGGAGGAGCCCTCCTTTTCGACTGGTTTTAGTCGATTAAGAAGGTTG
Line 783811: TGGGGTTTTGTATGTATGTTAAGATGATACCAGTTTTTGTCTTCATCACGGCTCTGAGCTGTTCAGATAGCTTATTCATCTAAGGTGAG>id=GCF_009
Line 783812: 873245.2_mBalMus1.pri.v3|NC_045788.1|144968589|0acaaggagtagcccccactagccacaactagaggaagtccacatgcagcaat
Line 783813: gaagacacaacgcagccaaaaataaataatgaataaataaataagttaattaattaattaattaaaaaaataagagtagagtggaaattcaggaagttga
I certainly hope this is not a fatal flaw requiring a total restart but i suspect it is. Wondering about the cause here. Any ideas?
from cactus.
@glennhickey any chance it's the pipes in the fasta headers that are causing this issue?
from cactus.
Could be. When I try to change some names in the test data to look like yours, I get an error right away
RuntimeError: An invalid character was found in the first word of a fasta header. Acceptable characters for headers in an assembly hub include alphanumeric characters plus '_', '-', ':', and '.'. Please modify your headers to eliminate other characters. The offending header: 'id=simMouse_chr6|873245.2_mBalMus1.pri.v1|NC_045788.1|144968589|0' in 'simMouse_chr6'
from cactus.
it's funny that I don't get that error until much later - does "sanitize_fasta" deal with |
's? They are sadly common in NCBI downloaded genomes.
Anyway I went for the clean/full restart to see if the error is reproducible or if it could have been related to some ?transient read/write issue.
from cactus.
That check is on by default because the ucsc genome browser doesn't (or didn't) support these characters in assembly hubs. If I disable the check by setting checkAssemblyHub="0"
in the config, then my test runs through fine.
halStats em.hal --sequenceStats simMouse_chr6
SequenceName, Length, NumTopSegments, NumBottomSegments
873245.2_mBalMus1.pri.v3|NC_045788.1|144968589|0, 636262, 46692, 0
873245.2_mBalMus1.pri.v1|NC_045788.1|144968589|0, 850, 104, 0
873245.2_mBalMus1.pri.v4|NC_045788.1|144968589|0, 1250, 129, 0
but since the check is on by default, I don't know why it didn't complain for you. It's not in cactus_santiize_fasta_headers
but slightly upstream when running cactus
.
In any case, I do not know what caused your error, and suggest double checking your input file. But if you are sure it's cactus causing the problem, please send me the input so I can try to reproduce.
from cactus.
Related Issues (20)
- unrecognized arguments: --maskAlpha HOT 4
- How to obtain the evolutionary order of root during merge hal file HOT 1
- Alt nodes
- ancestral reconstructed HOT 2
- Mapping settings
- HAL to vg for SV calling, vg index Assertion `idx < this->size()' failed HOT 1
- read input data (listed in seqfile) from local directory, not web location (url)? HOT 2
- Error in cactus-graphmap-join : ['vg clip -sS - -P CamPar;] exited 141: stderr=vg: invalid option -- 'S' HOT 1
- Segmental duplications HOT 1
- Minigraph-cactus VCF has overlapping variants after left align HOT 3
- Locations When Using cactus-hal2maf HOT 1
- CDS HOT 2
- cactus-graphmap-split taking a long time - is this expected? HOT 2
- toil issuing too many jobs at a time HOT 4
- PBS PRO - workflow HOT 1
- How do I create d2 d8 d10 filtered graph pangenomes from a clip graph pangenome? My steps might be incorrect. HOT 3
- Long reads mapping - tutorial HOT 1
- Failed job cactus_consolidate HOT 1
- MAF sequence names HOT 2
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from cactus.