Comments (3)
I guess you solved your minimap2 issue if you have generated output from teloclip-extract.
Please try this example workflow.
Make sure you have a stable release version for teloclip installed. You will also need samtools and minimap2.
# Install from PyPi
pip install teloclip
# Check version is 0.0.4
teloclip --version
#teloclip 0.0.4
First, it is advisable to view all reads that that overhang the end of a contig (no filtering for telomeric motifs).
You can do this by visualising the output file primary_overhangs.bam
from this command in an alignment viewer i.e. IGV or Geneious.
# Create index of reference fasta
samtools faidx ref.fa
# Map hifi reads with mm2;
# exclude secondary alignments;
# keep only alignments that overhang the end of a contig;
# sort alignments and save as bamfile.
minimap2 -ax map-hifi ref.fa hifi_reads.fq.gz | samtools view -h -F 0x100 | teloclip --ref ref.fa.fai | samtools sort > primary_overhangs.bam
Some contigs will have MANY more overhangs than others, these are likely to be mitochondrial or chloroplast genomes. Be careful to identify these contigs and exclude them from extension steps.
Next, you can filter the primary overhang alignments for reads that contain the motif 'AAACCCT' in the overhang section by running the previous output through teloclip
again with the --motifs option on.
We can then pass these filtered alignments to teloclip-extract
which will write the reads to separate fasta files for each reference contig end.
samtools view -h primary_overhangs.bam | teloclip --ref ref.fa.fai --motifs AAACCCT | teloclip-extract --refIdx ref.fa.fai --extractReads --extractDir SplitOverhangs
You will have output file that look like this for each contig where at least one overhang with the motif was found:
# Overhang reads for the Left and Right ends of chrom 14
SplitOverhangs/14_L.fasta
SplitOverhangs/14_R.fasta
The soft-clipped or "overhang" segment of the read will be in lowercase letters. This will be at the start for reads that overhang the left end of the contig, or at the end for reads overhanging the right end of the contig.
To manually extend the contigs, you should first check the BAM file to see that:
- the alignments are well anchored on the contig,
- the overhangs generally agree with each other,
- the overhangs actually contain runs of your query motif (if not try running teloclip with multiple copies of your repeat i.e.
--motifs AAACCCTAAACCCTAAACCCT
) - and that the contig end does not have an unusually high number of alignments (this may mean you have a circular contig or a contig ending in a repeat element).
If the alignments pass this check you can usually select the longest overhang region (lowercase in the teloclip-extract output) and paste these bases onto the end of your contig.
from teloclip.
The run log of miniasm
[M::main] ===> Step 1: reading read mappings <===
[M::ma_hit_read::0.0131.07] read 32554 hits; stored 7950 hits and 3 sequences (16454807 bp)
[M::main] ===> Step 2: 1-pass (crude) read selection <===
[M::ma_hit_sub::0.0141.07] 3 query sequences remain after sub
[M::ma_hit_cut::0.0141.07] 7816 hits remain after cut
[M::ma_hit_flt::0.0141.07] 3386 hits remain after filtering; crude coverage after filtering: 638.37
[M::main] ===> Step 3: 2-pass (fine) read selection <===
[M::ma_hit_sub::0.0141.06] 3 query sequences remain after sub
[M::ma_hit_cut::0.0141.06] 3386 hits remain after cut
[M::ma_hit_contained::0.014*1.06] 1 sequences and 0 hits remain after containment removal
[M::main] ===> Step 4: graph cleaning <===
[M::ma_sg_gen] read 0 arcs
[M::main] ===> Step 4.1: transitive reduction <===
[M::asg_arc_del_trans] transitively reduced 0 arcs
[M::main] ===> Step 4.2: initial tip cutting and bubble popping <===
[M::asg_cut_tip] cut 1 tips
[M::asg_arc_del_multi] removed 0 multi-arcs
[M::asg_arc_del_asymm] removed 0 asymmetric arcs
[M::asg_pop_bubble] popped 0 bubbles and trimmed 0 tips
[M::main] ===> Step 4.3: cutting short overlaps (3 rounds in total) <===
[M::asg_arc_del_short] removed 0 short overlaps
[M::asg_arc_del_short] removed 0 short overlaps
[M::asg_arc_del_short] removed 0 short overlaps
[M::main] ===> Step 4.4: removing short internal sequences and bi-loops <===
[M::asg_cut_internal] cut 0 internal sequences
[M::asg_cut_biloop] cut 0 small bi-loops
[M::asg_cut_tip] cut 0 tips
[M::asg_pop_bubble] popped 0 bubbles and trimmed 0 tips
[M::main] ===> Step 4.5: aggressively cutting short overlaps <===
[M::asg_arc_del_short] removed 0 short overlaps
[M::main] ===> Step 5: generating unitigs <===
[M::main] Version: 0.3-r179
[M::main] CMD: miniasm -f no-gap.id_B01.fasta read.paf
[M::main] Real time: 0.034 sec; CPU: 0.035 sec
from teloclip.
Another question is, what does the small base in the extracted sequence represent?
from teloclip.
Related Issues (20)
- Automatically extend contigs HOT 1
- error "invalid mode: 'rU' " in teloclip (v. bioconda)
- Refresh codebase
- Automate testing HOT 1
- Package Distribution HOT 1
- Feature: Align and Extend HOT 5
- No 'rU' option in Python 3.12 HOT 4
- Improve readability
- Confusing about input and output file HOT 17
- Feature: Fuzzy motif search
- Add metadata to extracted overhang reads HOT 1
- Missing isMotifInClip()
- Calculate alignment end position from CIGAR HOT 1
- Verify: Correct read slice coords for negative strand alignments HOT 2
- Summary report option
- Interactive Contig extension HOT 1
- functionality to extract reads at NNN gaps in scaffolds? HOT 2
- NNNNN reads HOT 8
- Find existing telo repeats in contigs HOT 1
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from teloclip.